ACAT2 cDNA ORF Clone, Human, untagged

Cat: HG15552-UT

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All ACAT2 Reagents

CRO Services

Product recommended


All ACAT2 Reagents

ACAT2 cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1194 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human acetyl-CoA acetyltransferase 2.

Plasmid

Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6.1kb+1.19kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ACAT2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ACAT2 cDNA ORF Clone, Human, untagged Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5613

ACAT2 Background Information

Acyl-coenzyme A: cholesterol acyltransferase (ACAT) is an intracellular enzyme that produces cholesteryl esters in various tissues. In mammals, two ACAT genes (ACAT1 and ACAT2) have been identified. Together, these two enzymes are involved in storing cholesteryl esters as lipid droplets, in macrophage foam-cell formation, in absorbing dietary cholesterol, and in supplying cholesteryl esters as part of the core lipid for lipoprotein synthesis and assembly. The key difference in tissue distribution of ACAT1 and ACAT2 between humans, mice and monkeys is that, in adult human liver (including hepatocytes and bile duct cells), the major enzyme is ACAT1, rather than ACAT2. There is compelling evidence implicating a role for ACAT1 in macrophage foam-cell formation, and for ACAT2 in intestinal cholesterol absorption.Ubiquitin linkage to cysteine is an unconventional modification targeting protein for degradation. However, the physiological regulation of cysteine ubiquitylation is still mysterious. Here we found that ACAT2, a cellular enzyme converting cholesterol and fatty acid to cholesteryl esters, was ubiquitylated on Cys277 for degradation when the lipid level was low. gp78-Insigs catalysed Lys48-linked polyubiquitylation on this Cys277. A high concentration of cholesterol and fatty acid, however, induced cellular reactive oxygen species (ROS) that oxidized Cys277, resulting in ACAT2 stabilization and subsequently elevated cholesteryl esters. Furthermore, ACAT2 knockout mice were more susceptible to high-fat diet-associated insulin resistance. By contrast, expression of a constitutively stable form of ACAT2 (C277A) resulted in higher insulin sensitivity. ACAT2 is an appealing target for therapy to reduce coronary heart disease.
Full Name
acetyl-CoA acetyltransferase 2

ACAT2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ACAT2 cDNA ORF Clone in Cloning Vector, Rat RG80686-U
ACAT2 cDNA ORF Clone, Rat, untagged RG80686-UT
ACAT2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80686-ACGLN
ACAT2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80686-ACG
ACAT2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80686-ANG
ACAT2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80686-ACR
ACAT2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80686-ANR
ACAT2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80686-CF
ACAT2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80686-NF
ACAT2 cDNA ORF Clone, Rat, C-His tag RG80686-CH
ACAT2 cDNA ORF Clone, Rat, N-His tag RG80686-NH
ACAT2 cDNA ORF Clone, Rat, C-HA tag RG80686-CY
ACAT2 cDNA ORF Clone, Rat, N-HA tag RG80686-NY
ACAT2 cDNA ORF Clone, Rat, C-Myc tag RG80686-CM
ACAT2 cDNA ORF Clone, Rat, N-Myc tag RG80686-NM
ACAT2 qPCR Primer Pairs, Rat RP300650

ACAT2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ACAT2 cDNA ORF Clone in Cloning Vector, Mouse MG52596-G
ACAT2 cDNA ORF Clone, Mouse, untagged MG52596-UT
ACAT2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52596-ACG
ACAT2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52596-ACGLN
ACAT2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52596-ANG
ACAT2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52596-ACR
ACAT2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52596-ANR
ACAT2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52596-CF
ACAT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52596-NF
ACAT2 cDNA ORF Clone, Mouse, C-His tag MG52596-CH
ACAT2 cDNA ORF Clone, Mouse, N-His tag MG52596-NH
ACAT2 cDNA ORF Clone, Mouse, C-HA tag MG52596-CY
ACAT2 cDNA ORF Clone, Mouse, N-HA tag MG52596-NY
ACAT2 cDNA ORF Clone, Mouse, C-Myc tag MG52596-CM
ACAT2 cDNA ORF Clone, Mouse, N-Myc tag MG52596-NM
ACAT2 qPCR Primer Pairs, Mouse MP202467

ACAT2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ACAT2 cDNA ORF Clone in Cloning Vector, Human HG15552-G
ACAT2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15552-ACG
ACAT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15552-ACGLN
ACAT2 cDNA ORF Clone, Human, N-GFPSpark® tag HG15552-ANG
ACAT2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15552-ACR
ACAT2 cDNA ORF Clone, Human, N-OFPSpark® tag HG15552-ANR
ACAT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15552-CF
ACAT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15552-NF
ACAT2 cDNA ORF Clone, Human, C-His tag HG15552-CH
ACAT2 cDNA ORF Clone, Human, N-His tag HG15552-NH
ACAT2 cDNA ORF Clone, Human, C-HA tag HG15552-CY
ACAT2 cDNA ORF Clone, Human, N-HA tag HG15552-NY
ACAT2 cDNA ORF Clone, Human, C-Myc tag HG15552-CM
ACAT2 cDNA ORF Clone, Human, N-Myc tag HG15552-NM
ACAT2 qPCR Primer Pairs, Human HP104172
info info
添加购物车成功! 添加购物车失败!