Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Human, C-Myc tag

Cat: HG15585-CM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Acyl-coenzyme A Thioesterase 8 Reagents

CRO Services

Product recommended


All Acyl-coenzyme A Thioesterase 8 Reagents

Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Human, C-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
960 bp
Description
Full length Clone DNA of Human acyl-CoA thioesterase 8 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Human, C-Myc tag Alternative Names

hACTE-III cDNA ORF Clone, Human;HNAACTE cDNA ORF Clone, Human;hTE cDNA ORF Clone, Human;PTE-1 cDNA ORF Clone, Human;PTE-2 cDNA ORF Clone, Human;PTE1 cDNA ORF Clone, Human;PTE2 cDNA ORF Clone, Human

Acyl-coenzyme A Thioesterase 8 Background Information

Full Name
acyl-CoA thioesterase 8

Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone in Cloning Vector, Mouse MG5A3183-U
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Mouse, untagged MG5A3183-UT
Acyl-coenzyme A Thioesterase 8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3183-ACGLN
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3183-ACG
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A3183-ANG
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3183-ACR
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A3183-ANR
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3183-CF
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3183-NF
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Mouse, C-His tag MG5A3183-CH
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Mouse, N-His tag MG5A3183-NH
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Mouse, C-HA tag MG5A3183-CY
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Mouse, N-HA tag MG5A3183-NY
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Mouse, C-Myc tag MG5A3183-CM
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Mouse, N-Myc tag MG5A3183-NM

Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone in Cloning Vector, Human HG15585-G
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Human, untagged HG15585-UT
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Human, C-GFPSpark® tag HG15585-ACG
Acyl-coenzyme A Thioesterase 8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15585-ACGLN
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Human, N-GFPSpark® tag HG15585-ANG
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Human, C-OFPSpark® tag HG15585-ACR
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Human, N-OFPSpark® tag HG15585-ANR
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15585-CF
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15585-NF
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Human, C-His tag HG15585-CH
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Human, N-His tag HG15585-NH
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Human, C-HA tag HG15585-CY
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Human, N-HA tag HG15585-NY
Acyl-coenzyme A Thioesterase 8 cDNA ORF Clone, Human, N-Myc tag HG15585-NM
Acyl-coenzyme A Thioesterase 8 qPCR Primer Pairs, Human HP104205
info info
添加购物车成功! 添加购物车失败!