Pedido rápido

Humano Aminoacylase-1/ACY1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human ACY1 Información de producto de clon de cDNA
Tamaño de cDNA:1227bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens aminoacylase 1 with N terminal Flag tag.
Sinónimo de gen:ACY1D, ACYLASE
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano Aminoacylase-1/ACY1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Humano Aminoacylase-1/ACY1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10549-ACG$225
Humano Aminoacylase-1/ACY1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10549-ACR$225
Humano Aminoacylase-1/ACY1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10549-ANG$225
Humano Aminoacylase-1/ACY1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10549-ANR$225
Humano Aminoacylase-1/ACY1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10549-CF$195
Humano Aminoacylase-1/ACY1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10549-CH$195
Humano Aminoacylase-1/ACY1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10549-CM$195
Humano Aminoacylase-1/ACY1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10549-CY$195
Humano Aminoacylase-1/ACY1 clonación del ADN o clonación génica(Vector de expresión)HG10549-M$75
Humano Aminoacylase-1/ACY1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10549-M-F$195
Humano Aminoacylase-1/ACY1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10549-NF$195
Humano Aminoacylase-1/ACY1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10549-NH$195
Humano Aminoacylase-1/ACY1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10549-NM$195
Humano Aminoacylase-1/ACY1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10549-NY$195
Humano Aminoacylase-1/ACY1 clonación del ADN o clonación génica(vector de clonación)HG10549-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Aminoacylase 1 (ACY1), a metalloenzyme that removes amide-linked ACY1 groups from amino acids and may play a role in regulating responses to oxidative stress. Both the C-terminal fragment found in the two-hybrid screen and full-length ACY1 co-immunoprecipitate with SphK1. Though both C-terminal and full-length proteins slightly reduce SphK1 activity measured in vitro, the C-terminal fragment inhibits while full-length ACY1 potentiates the effects of SphK1 on proliferation and apoptosis. It suggested that ACY1 physically interacts with SphK1 and may influence its physiological functions. As a homodimeric zinc-binding enzyme, Aminoacylase 1 catalyzes the hydrolysis of N alpha-acylated amino acids. Deficiency of Aminoacylase 1 due to mutations in the Aminoacylase 1 (ACY1) gene follows an autosomal-recessive trait of inheritance and is characterized by accumulation of N-acetyl amino acids in the urine.

  • Sommer A, et al. (2011) The molecular basis of aminoacylase 1 deficiency. Biochim Biophys Acta. 1812(6): 685-90.
  • Maceyka M, et al. (2004) Aminoacylase 1 is a sphingosine kinase 1-interacting protein. FEBS Lett. 568(1-3): 30-4.
  • Cook RM, et al.(1993) Human aminoacylase-1. Cloning, sequence, and expression analysis of a chromosome 3p21 gene inactivated in small cell lung cancer. J Biol Chem. 268(23): 17010-7.
  • Size / Price
    Catálogo: HG10549-NF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.