After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano ADAM15 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human ADAM15 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_207191.1
Tamaño de cDNA:2319bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens ADAM metallopeptidase domain 15 with N terminal HA tag.
Sinónimo de gen:MDC15
Especie:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Fondo

ADAM15, also known as Metargidin, is a type I transmembrane glycoprotein belonging to the ADAM (A Disintegrin and Metalloprotease Domain) family of proteins and is widely expressed in different tissues and cell types. Members of this family contain an amino-terminal metalloprotease domain followed by a disintegrin domain, a cysteine-rich region and a membrane proximal EGF-like domain. The disintegrin domain of ADAM15/metargidin contains an RGD tripeptide sequence, suggesting that it may potentially interact with the integrin family of proteins. ADAM15 is a transmembrane multi-domain proteins implicated in proteolysis, cell-cell and cell-matrix interactions in various disease conditions. There is also evidence supporting a role for ADAM15 in angiogenesis and angioinvasion of tumor cells, which are critical for unrestrained tumor growth and metastatic spread. Given its diverse functions, ADAM15 may represent a pivotal regulatory component of tumor progression, an important target for therapeutic intervention, or emerge as a biomarker of disease progression.

Referencias
  • Poghosyan Z, et al. (2002) Phosphorylation-dependent interactions between ADAM15 cytoplasmic domain and Src family protein-tyrosine kinases. J Biol Chem. 277(7): 4999-5007.
  • Carl-McGrath S, et al. (2005) The disintegrin-metalloproteinases ADAM9, ADAM12, and ADAM15 are upregulated in gastric cancer. Int J Oncol. 26(1): 17-24.
  • Najy AJ, et al. (2008) ADAM15 supports prostate cancer metastasis by modulating tumor cell-endothelial cell interaction. Cancer Res. 68(4): 1092-9.
  • Maretzky T, et al. (2009) Characterization of the catalytic activity of the membrane-anchored metalloproteinase ADAM15 in cell-based assays. Biochem J. 420(1): 105-13.
  • Size / Price
    Catálogo: HG10517-NY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"