Pedido rápido

Humano activity-dependent neuroprotector homeobox clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human ADNP Información de producto de clon de cDNA
Tamaño de cDNA:3309bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens activity-dependent neuroprotector homeobox with C terminal His tag.
Sinónimo de gen:ADNP1, KIAA0784, ADNP
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano activity-dependent neuroprotector homeobox clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano activity-dependent neuroprotector homeobox clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11106-ACG$325
Humano activity-dependent neuroprotector homeobox clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11106-ACR$325
Humano activity-dependent neuroprotector homeobox clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11106-ANG$325
Humano activity-dependent neuroprotector homeobox clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11106-ANR$325
Humano activity-dependent neuroprotector homeobox clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11106-CF$295
Humano activity-dependent neuroprotector homeobox clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11106-CH$295
Humano activity-dependent neuroprotector homeobox clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11106-CM$295
Humano activity-dependent neuroprotector homeobox clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11106-CY$295
Humano activity-dependent neuroprotector homeobox clonación del ADN o clonación génica(Vector de expresión)HG11106-M$75
Humano activity-dependent neuroprotector homeobox clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11106-NF$295
Humano activity-dependent neuroprotector homeobox clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11106-NH$295
Humano activity-dependent neuroprotector homeobox clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11106-NM$295
Humano activity-dependent neuroprotector homeobox clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11106-NY$295
Humano activity-dependent neuroprotector homeobox clonación del ADN o clonación génica(vector de clonación)HG11106-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG11106-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.