After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human ADORA2A Información de producto de clon de cDNA
Tamaño de cDNA:1239bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens adenosine A2a receptor with N terminal His tag.
Sinónimo de gen:RDC8, hA2aR, ADORA2, ADORA2A
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG12307-ACG$225
Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG12307-ACR$225
Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG12307-ANG$225
Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG12307-CF$195
Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG12307-CH$195
Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG12307-CM$195
Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG12307-CY$195
Humano Adenosine Receptor A2a clonación del ADN o clonación génica(Vector de expresión)HG12307-G$75
Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG12307-NF$195
Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG12307-NH$195
Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG12307-NM$195
Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG12307-NY$195
Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación)HG12307-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG12307-NH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad4-5 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.