Pedido rápido

Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano ADORA2A Información de producto de clon de cDNA
    Tamaño de cDNA:1239bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens adenosine A2a receptor with N terminal His tag.
    Sinónimo de gen:RDC8, hA2aR, ADORA2, ADORA2A
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    ( We provide with ADORA2A qPCR primers for gene expression analysis, HP101912 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
    Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG12307-ACG$225
    Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG12307-ACR$225
    Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG12307-ANG$225
    Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG12307-CF$195
    Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG12307-CH$195
    Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG12307-CM$195
    Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG12307-CY$195
    Humano Adenosine Receptor A2a clonación del ADN o clonación génica(Vector de expresión)HG12307-G$75
    Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG12307-NF$195
    Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG12307-NH$195
    Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG12307-NM$195
    Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG12307-NY$195
    Humano Adenosine Receptor A2a clonación del ADN o clonación génica(vector de clonación)HG12307-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name

    This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily, which is subdivided into classes and subtypes. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein, an adenosine receptor of A2A subtype, uses adenosine as the preferred endogenous agonist and preferentially interacts with the G(s) and G(olf) family of G proteins to increase intracellular cAMP levels. It plays an important role in many biological functions, such as cardiac rhythm and circulation, cerebral and renal blood flow, immune function, pain regulation, and sleep. It has been implicated in pathophysiological conditions such as inflammatory diseases and neurodegenerative disorders. Alternative splicing results in multiple transcript variants. A read-through transcript composed of the upstream SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding.

    Immune Checkpoint
    Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

    Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Alchera E, Imarisio C, Mandili G, et al. Pharmacological Preconditioning by Adenosine A2a Receptor Stimulation: Features of the Protected Liver Cell Phenotype. BioMed Research International. 2015;2015:286746.
  • Size / Price
    Catálogo: HG12307-NH
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.