Pedido rápido

Humano ARH3 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano ADPRHL2 Información de producto de clon de cDNA
    Tamaño de cDNA:1092bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens ADP-ribosylhydrolase like 2 with C terminal His tag.
    Sinónimo de gen:ARH3, FLJ20446, ADPRHL2
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    ( We provide with ADPRHL2 qPCR primers for gene expression analysis, HP102089 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Humano ARH3 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.