Pedido rápido

Humano RAGE/AGER transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

  • Human AGER transcript variant 1 natural ORF mammalian expression plasmid, C-Flag tag
Hoja de datosReseñasProductos relacionadosProtocolos
Humano AGER Información de producto de clon de cDNA
Tamaño de cDNA:1215bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens advanced glycosylation end product-specific receptor, transcript variant 1 with C terminal Flag tag.
Sinónimo de gen:RAGE, MGC22357, AGER
Sitio de restricción:KpnI + XbaI (6kb + 1.25kb)
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
( We provide with AGER qPCR primers for gene expression analysis, HP101481 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano AGER Gene Plasmid Map
Human AGER transcript variant 1 natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano RAGE/AGER transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Humano RAGE/AGER transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11629-ACG$225
Humano RAGE/AGER transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11629-ACR$225
Humano RAGE/AGER transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11629-CF$195
Humano RAGE/AGER transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11629-CH$195
Humano RAGE/AGER transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11629-CM$195
Humano RAGE/AGER transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11629-CY$195
Humano AGER transcript variant 1 Gene cDNA clone plasmidHG11629-M$75
Humano RAGE/AGER transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11629-NF$195
Humano RAGE/AGER transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11629-NH$195
Humano RAGE/AGER transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11629-NM$195
Humano RAGE/AGER transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11629-NY$195
Humano RAGE/AGER transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG11629-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Receptor for Advanced Glycosylation End Products (RAGE, or AGER) is a member of the immunoglobulin super-family transmembrane proteins, as a signal transduction receptor which binds advanced glycation endproducts, certain members of the S100/calgranulin family of proteins, high mobility group box 1 (HMGB1), advanced oxidation protein products, and amyloid (beta-sheet fibrils). Initial studies investigating the role of RAGE in renal dysfunction focused on diabetes, neurodegenerative disorders, and inflammatory responses. However, RAGE also has roles in the pathogenesis of renal disorders that are not associated with diabetes, such as obesity-related glomerulopathy, doxorubicin-induced nephropathy, hypertensive nephropathy, lupus nephritis, renal amyloidosis, and ischemic renal injuries. RAGE represents an important factor in innate immunity against pathogens, but it also interacts with endogenous ligands, resulting in chronic inflammation. RAGE signaling has been implicated in multiple human illnesses, including atherosclerosis, arthritis, Alzheimer's disease, atherosclerosis and aging associated diseases.

  • Zhou Z, et al. (2011) RAGE and its ligands in bone metabolism. Front Biosci (Schol Ed). 3: 768-76.
  • Mosquera JA. (2010) Role of the receptor for advanced glycation end products (RAGE) in inflammation]. Invest Clin. 51(2): 257-68.
  • D'Agati V, et al. (2010) RAGE and the pathogenesis of chronic kidney disease. Nat Rev Nephrol. 6(6): 352-60.
  • Size / Price
    Catálogo: HG11629-CF
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.