GPAT4 cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

GPAT4 cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1371 bp
Description
Full length Clone DNA of Human 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GPAT4 cDNA ORF Clone, Human, C-HA tag: Alternative Names

1-AGPAT6 cDNA ORF Clone, Human; LPAAT-zeta cDNA ORF Clone, Human; LPAATZ cDNA ORF Clone, Human; TSARG7 cDNA ORF Clone, Human

GPAT4 Background Information

Full Name
glycerol-3-phosphate acyltransferase 4
Add to Cart Successfully Add to Cart Failed