Pedido rápido

Humano Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human AGT Información de producto de clon de cDNA
Tamaño de cDNA:1446bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens angiotensinogen (serpin peptidase inhibitor, clade A, member 8) with C terminal Flag tag.
Sinónimo de gen:ANHU, FLJ92595, FLJ97926, SERPINA8
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Humano Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10994-ACG$225
Humano Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10994-ACR$225
Humano Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10994-CF$195
Humano Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10994-CH$195
Humano Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10994-CM$195
Humano Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10994-CY$195
Humano Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(Vector de expresión)HG10994-M$75
Humano Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10994-NF$195
Humano Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10994-NH$195
Humano Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10994-NM$195
Humano Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10994-NY$195
Humano Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación)HG10994-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Angiotensinogen, also known as AGT and SerpinA8, is a member of the serpin family. It is an α-2-globulin that is produced constitutively and released into the circulation mainly by the liver. Angiotensinogen is a essential component of the renin-angiotensin system (RAS) and a potent regulator of blood pressure. Angiotensinogen can be schematically considered to consist of a combination of an angiotensin I (Ang I) function, located at the N-terminal end, and the presence of a serpin (serine protease inhibitor) structure at the opposite end. Angiotensinogen is cleaved into three chains: Angiotensin-1 (Ang I), Angiotensin-2 (Ang II), and Angiotensin-3 (Ang III). Angiotensin-1 is a substrate of ACE (angiotensin converting enzyme) that removes a dipeptide to yield the physiologically active peptide angiotensin-2. Angiotensin-1 and angiotensin-2 can be further processed to generate angiotensin-3, angiotensin-4. Angiotensin 1-7 is cleaved from angiotensin-2 by ACE2. Angiotensin-2 acts directly on vascular smooth muscle as a potent vasoconstrictor, affects cardiac contractility and heart rate through its action on the sympathetic nervous system. Defects in AGT are associated with susceptibility to essential hypertension and renal tubular dysgenesis (RTD). Several serpins (antithrombin, maspin, pigment epithelial-derived factor, and kallistatin) have been recently shown to exert an antiangiogenic activity, suggesting a common mechanism of endothelial cell proliferation and migration. Angiotensinogen/AGT and its renin-cleaved product, des(Ang I)AGT, are also angiogenesis inhibitors, both in vitro and in vivo at concentrations within the range of those observed in plasma. The Angiotensinogen products, that is angiotensin II and possibly angiotensin II-related products, have been found to act locally in modulating adipose tissue growth in an autocrine/paracrine manner. The transient or chronic overexpression of angiotensinogen in adipose tissue favors lipogenesis in adipocytes and leads to a 'vicious' circle whereby adipose tissue development is further increased.

  • Ailhaud G, et al. (2002) Angiotensinogen, adipocyte differentiation and fat mass enlargement. Curr Opin Clin Nutr Metab Care. 5(4): 385-9.
  • Corvol P, et al. (2003) Inhibition of angiogenesis: a new function for angiotensinogen and des(angiotensin I)angiotensinogen. Curr Hypertens Rep. 5(2): 149-54.
  • Size / Price
    Catálogo: HG10994-CF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.