After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano AHNAK2/AHNAK nucleoprotein 2 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human AHNAK2 Información de producto de clon de cDNA
Gene_bank_ref_id:BC049216
Tamaño de cDNA:1452bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens AHNAK nucleoprotein 2 DNA.
Sinónimo de gen:C14orf78
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano AHNAK2/AHNAK nucleoprotein 2 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano AHNAK2/AHNAK nucleoprotein 2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG15220-ACG$225
Humano AHNAK2/AHNAK nucleoprotein 2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG15220-ACR$225
Humano AHNAK2/AHNAK nucleoprotein 2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG15220-ANG$225
Humano AHNAK2/AHNAK nucleoprotein 2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG15220-ANR$225
Humano AHNAK2/AHNAK nucleoprotein 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG15220-CF$195
Humano AHNAK2/AHNAK nucleoprotein 2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG15220-CH$195
Humano AHNAK2/AHNAK nucleoprotein 2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG15220-CM$195
Humano AHNAK2/AHNAK nucleoprotein 2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG15220-CY$195
Humano AHNAK2/AHNAK nucleoprotein 2 clonación del ADN o clonación génica(Vector de expresión)HG15220-G$75
Humano AHNAK2/AHNAK nucleoprotein 2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG15220-NF$195
Humano AHNAK2/AHNAK nucleoprotein 2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG15220-NH$195
Humano AHNAK2/AHNAK nucleoprotein 2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG15220-NM$195
Humano AHNAK2/AHNAK nucleoprotein 2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG15220-NY$195
Humano AHNAK2/AHNAK nucleoprotein 2 clonación del ADN o clonación génica(vector de clonación)HG15220-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG15220-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"