After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano Aryl Hydrocarbon Receptor clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human AHR Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001621.3
Tamaño de cDNA:2547bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens aryl hydrocarbon receptor with C terminal His tag.
Sinónimo de gen:AHR
Especie:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-AHR-His
Sitio de restricción:KpnI + NotI (6kb + 2.59kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human AHR Gene Plasmid Map
Human AHR ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano Aryl Hydrocarbon Receptor clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano Aryl Hydrocarbon Receptor clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10456-ACG$325
Humano Aryl Hydrocarbon Receptor clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10456-ACR$325
Humano Aryl Hydrocarbon Receptor clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10456-ANG$325
Humano Aryl Hydrocarbon Receptor clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10456-ANR$325
Humano Aryl Hydrocarbon Receptor clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10456-CF$295
Humano Aryl Hydrocarbon Receptor clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10456-CH$295
Humano Aryl Hydrocarbon Receptor clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10456-CM$295
Humano Aryl Hydrocarbon Receptor clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10456-CY$295
Humano Aryl Hydrocarbon Receptor clonación del ADN o clonación génica(Vector de expresión)HG10456-M$75
Humano Aryl Hydrocarbon Receptor clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10456-NF$295
Humano Aryl Hydrocarbon Receptor clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10456-NH$295
Humano Aryl Hydrocarbon Receptor clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10456-NM$295
Humano Aryl Hydrocarbon Receptor clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10456-NY$295
Humano Aryl Hydrocarbon Receptor clonación del ADN o clonación génica(vector de clonación)HG10456-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG10456-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
DisponibilidadIn Stock
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
  • Human AHR ORF mammalian expression plasmid, C-His tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"