Pedido rápido

Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación)

  • Human AIF1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Hoja de datosReseñasProductos relacionadosProtocolos
Humano AIF1 Información de producto de clon de cDNA
Gene_bank_ref_id:BC009474
Tamaño de cDNA:444bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens allograft inflammatory factor 1.
Sinónimo de gen:DADB-70P7.8, AIF-1, IBA1, IRT-1, IRT1, AIF1
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-AIF1
Sitio de restricción:KpnI + XbaI (6.1kb + 0.44kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with AIF1 qPCR primers for gene expression analysis, HP102877 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano AIF1 Gene Plasmid Map
Human AIF1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14227-ACG$225
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14227-ACR$225
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14227-ANG$225
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14227-ANR$225
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14227-CF$195
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14227-CH$195
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14227-CM$195
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14227-CY$195
Humano IBA1/AIF1 clonación del ADN o clonación génica(Vector de expresión)HG14227-G$75
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14227-NF$195
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14227-NH$195
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14227-NM$195
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14227-NY$195
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación)HG14227-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

AIF1, also known as IBA1, is an actin-binding protein. AIF1 is expressed selectively in human macrophage-like cell lines, and in a subset of CD68(+) macrophages in the interstitial and perivascular spaces of human heart allografts. It is expressed in macrophages and neutrophils. AIF1 enhances membrane ruffling and RAC activation. AIF1 enhances the actin-bundling activity of LCP1. It also enhances lymphocyte migration. AIF1 may play a role in macrophage activation and function. It binds calcium and plays a role in RAC signaling and in phagocytosis. It promotes the proliferation of vascular smooth muscle cells and of T-lymphocytes.

Size / Price
Catálogo: HG14227-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad
Añadir a carroBulk Discount Requiry

Datasheet & Documentation

Contact Us
    Artículos vistos recientemente
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"