After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human AIF1 Información de producto de clon de cDNA
Gene_bank_ref_id:BC009474
Tamaño de cDNA:444bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens allograft inflammatory factor 1.
Sinónimo de gen:DADB-70P7.8, AIF-1, IBA1, IRT-1, IRT1, AIF1
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-AIF1
Sitio de restricción:KpnI + XbaI (6.1kb + 0.44kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human AIF1 Gene Plasmid Map
Human AIF1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14227-ACG$225
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14227-ACR$225
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14227-ANG$225
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14227-ANR$225
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14227-CF$195
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14227-CH$195
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14227-CM$195
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14227-CY$195
Humano IBA1/AIF1 clonación del ADN o clonación génica(Vector de expresión)HG14227-G$75
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14227-NF$195
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14227-NH$195
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14227-NM$195
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14227-NY$195
Humano IBA1/AIF1 clonación del ADN o clonación génica(vector de clonación)HG14227-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

AIF1, also known as IBA1, is an actin-binding protein. AIF1 is expressed selectively in human macrophage-like cell lines, and in a subset of CD68(+) macrophages in the interstitial and perivascular spaces of human heart allografts. It is expressed in macrophages and neutrophils. AIF1 enhances membrane ruffling and RAC activation. AIF1 enhances the actin-bundling activity of LCP1. It also enhances lymphocyte migration. AIF1 may play a role in macrophage activation and function. It binds calcium and plays a role in RAC signaling and in phagocytosis. It promotes the proliferation of vascular smooth muscle cells and of T-lymphocytes.

Size / Price
Catálogo: HG14227-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
DisponibilidadIn Stock
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
  • Human AIF1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Artículos vistos recientemente
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"