After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human AK4 Información de producto de clon de cDNA
Gene_bank_ref_id:BC016180
Tamaño de cDNA:672bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens adenylate kinase 4 with N terminal His tag.
Sinónimo de gen:AK3, AK3L1, AK3L2
Especie:Human
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG12406-ACG$225
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG12406-ACR$225
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG12406-ANG$225
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG12406-ANR$225
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG12406-CF$195
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG12406-CH$195
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG12406-CM$195
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG12406-CY$195
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(Vector de expresión)HG12406-G$75
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG12406-NF$195
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG12406-NH$195
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG12406-NM$195
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG12406-NY$195
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación)HG12406-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Adenylate kinase isoenzyme 4, mitochondrial, also known as ATP-AMP transphosphorylase, Adenylate kinase 3-like, AK4 and AK3L1, is a member the adenylate kinase family. AK4 / AK3L1 is localized to the mitochondrial matrix. Adenylate kinases regulate the adenine and guanine nucleotide compositions within a cell by catalyzing the reversible transfer of phosphate group among these nucleotides. Five isozymes of adenylate kinase have been identified in vertebrates. Expression of these isozymes is tissue-specific and developmentally regulated. AK4 / AK3L1 catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP. It may also be active with GTP. Adenylate kinase 4 ( AK4 / AK3L1 ) is a unique member with no enzymatic activity in the adenylate kinase (AK) family although it shares high sequence homology with other AKs. It remains unclear what physiological function AK4 might play or why it is enzymatically inactive. AK4 / AK3L1 retains the capability of binding nucleotides. It has a glutamine residue instead of a key arginine residue in the active site well conserved in other AKs. The enzymatically inactive AK4 is a stress responsive protein critical to cell survival and proliferation. AK4 / AK3L1 is likely that the interaction with the mitochondrial inner membrane protein ANT is important for AK4 to exert the protective benefits to cells under stress. AK4 / AK3L1 also acts on the specific mechanism of energy metabolism rather than control of the homeostasis of the ADP pool ubiquitously.

Size / Price
Catálogo: HG12406-NH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"