AKR1B1 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

AKR1B1 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
951 bp
Description
Full length Clone DNA of Human aldo-keto reductase family 1, member B1 (aldose reductase) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

AKR1B1 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

ADR cDNA ORF Clone, Human; ALDR1 cDNA ORF Clone, Human; ALR2 cDNA ORF Clone, Human; AR cDNA ORF Clone, Human; MGC1804 cDNA ORF Clone, Human

AKR1B1 Background Information

Aldose reductase (AKR1B1) belongs to the aldo/keto reductase superfamily. AKR1B1 is a NADPH-dependent aldo-keto reductase best known as the rate-limiting enzyme of the polyol pathway. Expression of AKR1B1 was the highest in lens and retina. It is the first enzyme in the polyol pathway through which glucose is converted to sorbitol which is important for the function of various organs in the body, and has been implicated in the etiology of diabetic complications. AKR1B1 is quite abundant in the collecting tubule cells and thought to provide protection against hypertonic environment. Some human tissues contain AKR1B1 as well as AKR1B1, a closely related member of the aldo-keto reductase superfamily.
Full Name
aldo-keto reductase family 1, member B1 (aldose reductase)
References
  • Huang SP, et al. (2010) Aldo-Keto Reductases in the Eye. Journal of Ophthalmology. 326 (3): 625-36.
  • Aida K, et al. (2000) Disruption of Aldose Reductase Gene (Akr1b1) Causes Defect in Urinary Concentrating Ability and Divalent Cation Homeostasis. Biochemical and Biophysical Research Communications.277 (2): 281-6.
  • Liao CS, et al. (2009) Regulation of AKR1B1 by thyroid hormone and its receptors. Molecular and Cellular Endocrinology. 307 (1-2): 109-17.
  • Baba SP, et al. (2009) Posttranslational glutathiolation of aldose reductase (AKR1B1): A possible mechanism of protein recovery from S-nitrosylation. Chemico-Biological Interactions. 178 (1-3): 250-8.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait