Pedido rápido

Text Size:AAA

Humano AKT1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human AKT1 Información de producto de clon de cDNA
Tamaño de cDNA:1443bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens v-akt murine thymoma viral oncogene homolog 1 with N terminal His tag.
Sinónimo de gen:AKT, PKB, RAC, PRKBA, MGC99656, PKB-ALPHA, RAC-ALPHA, AKT1
Sitio de restricción:KpnI + XbaI (6kb + 1.49kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human AKT1 Gene Plasmid Map
Human AKT1 natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano AKT1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Product nameProduct name

v-akt murine thymoma viral oncogene homolog 1 (AKT1), or protein kinase B-alpha (PKB-ALPHA) is a serine-threonine protein kinase, belonging to the Protein Kinase Superfamily. AKT1 is a major mediator of the responses to insulin, insulin-like growth factor 1 (IGF1), and glucose. AKT1 also plays a key role in the regulation of both muscle cell hypertrophy and atrophy. AKT1 activity is required for physiologic cardiac growth in response to IGF1 stimulation or exercise training. In contrast, AKT1 activity was found to antagonize pathologic cardiac growth that occurs in response to endothelin 1 stimulation or pressure overload. AKT1 selectively promotes physiological cardiac growth while AKT2 selectively promotes insulin-stimulated cardiac glucose metabolism. AKT1 deletion prevented tumor initiation as well as tumor progression, coincident with decreased Akt signaling in tumor tissues. AKT1 is the primary Akt isoform activated by mutant K-ras in lung tumors, and that AKT3 may oppose AKT1 in lung tumorigenesis and lung tumor progression. A number of separate studies have implicated AKT1 as an inhibitor of breast epithelial cell motility and invasion. AKT1 may have a dual role in tumorigenesis, acting not only pro-oncogenically by suppressing apoptosis but also anti-oncogenically by suppressing invasion and metastasis.

  • Hollander MC, et al. (2011) Akt1 deletion prevents lung tumorigenesis by mutant K-ras. Oncogene. 30(15): 1812-21.
  • Devaney JM, et al. (2011) AKT1 polymorphisms are associated with risk for metabolic syndrome. Hum Genet. 129(2): 129-39.
  • Dillon RL, et al. (2010) Distinct biological roles for the akt family in mammary tumor progression. Cancer Res. 70(11): 4260-4.
  • Toker A, et al. (2006) Akt signaling and cancer: surviving but not moving on. Cancer Res. 66(8): 3963-6.
  • Muslin AJ, et al. (2006) Role of Akt in cardiac growth and metabolism. Novartis Found Symp. 274: 118-26.
  • Size / Price
    Catálogo: HG10763-NH
    Precio de lista: 
    Precio:      (You Save: )
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    • Human AKT1 natural ORF mammalian expression plasmid, N-His tag
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.