Pedido rápido

Humano AKT1S1/PRAS40 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human AKT1S1 Información de producto de clon de cDNA
Tamaño de cDNA:771bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens AKT1 substrate 1 (proline-rich), transcript variant 2 with N terminal His tag.
Sinónimo de gen:AKT1S1, Lob, PRAS40, MGC2865
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano AKT1S1/PRAS40 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano AKT1S1/PRAS40 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10092-ACG$225
Humano AKT1S1/PRAS40 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10092-ACR$225
Humano AKT1S1/PRAS40 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10092-ANG$225
Humano AKT1S1/PRAS40 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10092-ANR$225
Humano AKT1S1/PRAS40 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10092-CF$195
Humano AKT1S1/PRAS40 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10092-CH$195
Humano AKT1S1/PRAS40 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10092-CM$195
Humano AKT1S1/PRAS40 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10092-CY$195
Humano AKT1S1/PRAS40 transcript variant 2 clonación del ADN o clonación génica(Vector de expresión)HG10092-M$75
Humano AKT1S1/PRAS40 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10092-M-F$195
Humano AKT1S1/PRAS40 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10092-NF$195
Humano AKT1S1/PRAS40 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10092-NH$195
Humano AKT1S1/PRAS40 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10092-NM$195
Humano AKT1S1/PRAS40 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10092-NY$195
Humano AKT1S1/PRAS40 transcript variant 2 clonación del ADN o clonación génica(vector de clonación)HG10092-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG10092-NH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.