After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano ALDH2 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human ALDH2 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_000690
Tamaño de cDNA:1554bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens aldehyde dehydrogenase 2 family (mitochondrial) with N terminal Flag tag.
Sinónimo de gen:ALDH2
Especie:Human
Vector:pCMV3-N-FLAG
Plasmid:pCMV3-Flag-ALDH2
Sitio de restricción:KpnI + XbaI (6kb + 1.59kb)
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human ALDH2 Gene Plasmid Map
Human ALDH2 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano ALDH2 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Humano ALDH2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG12064-ACG$245
Humano ALDH2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG12064-ACR$245
Humano ALDH2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG12064-ANG$245
Humano ALDH2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG12064-ANR$245
Humano ALDH2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG12064-CF$215
Humano ALDH2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG12064-CH$215
Humano ALDH2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG12064-CM$215
Humano ALDH2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG12064-CY$215
Humano ALDH2 clonación del ADN o clonación génica(Vector de expresión)HG12064-G$75
Humano ALDH2 clonación del ADN o clonación génica(vector de clonación)HG12064-G-N$215
Humano ALDH2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG12064-NF$215
Humano ALDH2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG12064-NH$215
Humano ALDH2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG12064-NM$215
Humano ALDH2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG12064-NY$215
Humano ALDH2 clonación del ADN o clonación génica(vector de clonación)HG12064-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG12064-NF
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
DisponibilidadIn Stock
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
  • Human ALDH2 natural ORF mammalian expression plasmid, N-Flag tag
    Artículos vistos recientemente
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"