Pedido rápido

Text Size:AAA

Humano ALK-6 / BMPR1B clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human BMPR1B Información de producto de clon de cDNA
Tamaño de cDNA:1509bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens bone morphogenetic protein receptor, type I B with C terminal His tag.
Sinónimo de gen:ALK6, ALK-6, CDw293, BMPR1B
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano ALK-6 / BMPR1B clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano ALK-6 / BMPR1B clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10460-ACG$245
Humano ALK-6 / BMPR1B clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10460-ACR$245
Humano ALK-6 / BMPR1B clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10460-CF$215
Humano ALK-6 / BMPR1B clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10460-CH$215
Humano ALK-6 / BMPR1B clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10460-CM$215
Humano ALK-6 / BMPR1B clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10460-CY$215
Humano ALK-6 / BMPR1B clonación del ADN o clonación génica(Vector de expresión)HG10460-M$75
Humano ALK-6 / BMPR1B clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10460-M-F$215
Humano ALK-6 / BMPR1B clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10460-NF$215
Humano ALK-6 / BMPR1B clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10460-NH$215
Humano ALK-6 / BMPR1B clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10460-NM$215
Humano ALK-6 / BMPR1B clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10460-NY$215
Humano ALK-6 / BMPR1B clonación del ADN o clonación génica(vector de clonación)HG10460-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

BMPR1B(bone morphogenetic protein receptor, type IB), also known as ALK6, is a a member of the bone morphogenetic protein (BMP) receptor family. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of 2 different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. BMPR1B is the major transducer of signals in precartilaginous condensations as demonstrated in experiments using constitutively active BMPR1B receptors. BMPR1B is a more effective trasducer of GDF5 than BMPR1A. Unlike BMPR1A null mice, which die at an early embryonic stage, BMPR1B null mice are viable.

  • Ide H, et al. (1998) Assignment of the BMPR1A and BMPR1B genes to human chromosome 10q22.3 and 4q23--q24 byin situ hybridization and radiation hybrid map ping. Cytogenet. Cell Genet. 81(3-4): 285-6.
  • Mishina Y, et al. (2004) Bone morphogenetic protein type IA receptor signaling regulates postnatal osteoblast function and bone remodeling. J Biol Chem. 279(26): 27560-6.
  • Yoon BS, et al. (2005) Bmpr1a and Bmpr1b have overlapping functions and are essential for chondrogenesis in vivo. Proc Natl Acad Sci. 102(14): 5062-7.
  • Size / Price
    Catálogo: HG10460-CH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.