Pedido rápido

Humano Alkaline Phosphatase / ALPL clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Humano ALPL Información de producto de clon de cDNA
Tamaño de cDNA:1575bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens alkaline phosphatase, liver/bone/kidney with C terminal His tag.
Sinónimo de gen:HOPS, TNAP, TNSALP, AP-TNAP, FLJ40094, FLJ93059, MGC161443, MGC167935, ALPL
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
( We provide with ALPL qPCR primers for gene expression analysis, HP100469 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano Alkaline Phosphatase / ALPL clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano Alkaline Phosphatase / ALPL clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10440-ACG$245
Humano Alkaline Phosphatase / ALPL clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10440-ACR$245
Humano Alkaline Phosphatase / ALPL clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10440-CF$215
Humano Alkaline Phosphatase / ALPL clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10440-CH$215
Humano Alkaline Phosphatase / ALPL clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10440-CM$215
Humano Alkaline Phosphatase / ALPL clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10440-CY$215
Humano Alkaline Phosphatase / ALPL clonación del ADN o clonación génica(Vector de expresión)HG10440-M$75
Humano Alkaline Phosphatase / ALPL clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10440-M-F$215
Humano Alkaline Phosphatase / ALPL clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10440-NF$215
Humano Alkaline Phosphatase / ALPL clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10440-NH$215
Humano Alkaline Phosphatase / ALPL clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10440-NM$215
Humano Alkaline Phosphatase / ALPL clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10440-NY$215
Humano Alkaline Phosphatase / ALPL clonación del ADN o clonación génica(vector de clonación)HG10440-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

Alkaline phosphatase (ALPL) is a hydrolase enzyme responsible for removing phosphate groups from many types of molecules, including nucleotides, proteins, and alkaloids. The process of removing the phosphate group is called dephosphorylation. As the name suggests, alkaline phosphatases are most effective in an alkaline environment. It is sometimes used synonymously as basic phosphatase. Alkaline phosphatases (APs) are ubiquitous in many species, from bacteria to human. Four genes encode AP isoenzymes in humans and rodents. Three AP genes are expressed in a tissue-specific manner (i.e., placental, embryonic, and intestinal AP isoenzymes). Expression of the fourth AP gene is nonspecific to a single tissue and is especially abundant in bone, liver, and kidney. This isoenzyme is also called tissue-nonspecific alkaline phosphatase (TNAP). The enzyme tissue non-specific alkaline phosphatase (TNAP) belongs to the ectophosphatase family. TNAP is present in large amounts in bone in which it plays a role in mineralization.

  • Brun-Heath I, et al. (2011) Differential expression of the bone and the liver tissue non-specific alkaline phosphatase isoforms in brain tissues. Cell Tissue Res. 343(3): 521-36.
  • Whyte MP, et al. (1995) Alkaline phosphatase: placental and tissue-non-specific isoenzymes hydrolyze phosphoethanolamine, inorganic pyrophosphate, and pyridoxal 5-phosphate. J Clin Invest. 95: 1440-5.
  • Whyte MP. (1994) Hypophosphatasia and the role of alkaline phosphatase in skeletal mineralization. Endocrinol Rev. 4: 439-61.
  • Weinreb M, et al. (1990) Different pattern of alkaline phosphatase, osteopontin and osteocalcin expression in developing rat bone visualized by in situ hybridization. J Bone Miner Res. 5: 831-42.
  • Size / Price
    Catálogo: HG10440-CH
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.