Bone Alkaline Phosphatase cDNA ORF Clone, Human, C-His tag

Price:
Size:
Number:

Bone Alkaline Phosphatase cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1575 bp
Description
Full length Clone DNA of Human alkaline phosphatase, liver/bone/kidney with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Bone Alkaline Phosphatase cDNA ORF Clone, Human, C-His tag: Alternative Names

AP-TNAP cDNA ORF Clone, Human; APTNAP cDNA ORF Clone, Human; HOPS cDNA ORF Clone, Human; TNAP cDNA ORF Clone, Human; TNSALP cDNA ORF Clone, Human

Bone Alkaline Phosphatase Background Information

Alkaline phosphatase (ALPL) is a hydrolase enzyme responsible for removing phosphate groups from many types of molecules, including nucleotides, proteins, and alkaloids. The process of removing the phosphate group is called dephosphorylation. As the name suggests, alkaline phosphatases are most effective in an alkaline environment. It is sometimes used synonymously as basic phosphatase. Alkaline phosphatases (APs) are ubiquitous in many species, from bacteria to human. Four genes encode AP isoenzymes in humans and rodents. Three AP genes are expressed in a tissue-specific manner (i.e., placental, embryonic, and intestinal AP isoenzymes). Expression of the fourth AP gene is nonspecific to a single tissue and is especially abundant in bone, liver, and kidney. This isoenzyme is also called tissue-nonspecific alkaline phosphatase (TNAP). The enzyme tissue non-specific alkaline phosphatase (TNAP) belongs to the ectophosphatase family. TNAP is present in large amounts in bone in which it plays a role in mineralization.
Full Name
alkaline phosphatase, liver/bone/kidney
References
  • Brun-Heath I, et al. (2011) Differential expression of the bone and the liver tissue non-specific alkaline phosphatase isoforms in brain tissues. Cell Tissue Res. 343(3): 521-36.
  • Whyte MP, et al. (1995) Alkaline phosphatase: placental and tissue-non-specific isoenzymes hydrolyze phosphoethanolamine, inorganic pyrophosphate, and pyridoxal 5-phosphate. J Clin Invest. 95: 1440-5.
  • Whyte MP. (1994) Hypophosphatasia and the role of alkaline phosphatase in skeletal mineralization. Endocrinol Rev. 4: 439-61.
  • Weinreb M, et al. (1990) Different pattern of alkaline phosphatase, osteopontin and osteocalcin expression in developing rat bone visualized by in situ hybridization. J Bone Miner Res. 5: 831-42.
Add to Cart Successfully Add to Cart Failed