Pedido rápido

Text Size:AAA

Humano AMIGO2 / AMIGO-2 / alivin 1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano AMIGO2 Información de producto de clon de cDNA
    Tamaño de cDNA:1569bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens adhesion molecule with Ig-like domain 2 with N terminal Myc tag.
    Sinónimo de gen:ALI1, DEGA, AMIGO2
    Sitio de restricción:
    Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descripción de la secuencia:
    ( We provide with AMIGO2 qPCR primers for gene expression analysis, HP102412 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Humano AMIGO2 / AMIGO-2 / alivin 1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
    Humano AMIGO2 / AMIGO-2 / alivin 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG13735-ACG$245
    Humano AMIGO2 / AMIGO-2 / alivin 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG13735-ACR$245
    Humano AMIGO2 / AMIGO-2 / alivin 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG13735-CF$215
    Humano AMIGO2 / AMIGO-2 / alivin 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG13735-CH$215
    Humano AMIGO2 / AMIGO-2 / alivin 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG13735-CM$215
    Humano AMIGO2 / AMIGO-2 / alivin 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG13735-CY$215
    Humano AMIGO2 / AMIGO-2 / alivin 1 clonación del ADN o clonación génica(Vector de expresión)HG13735-G$75
    Humano AMIGO2 / AMIGO-2 / alivin 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG13735-NF$215
    Humano AMIGO2 / AMIGO-2 / alivin 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG13735-NH$215
    Humano AMIGO2 / AMIGO-2 / alivin 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG13735-NM$215
    Humano AMIGO2 / AMIGO-2 / alivin 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG13735-NY$215
    Humano AMIGO2 / AMIGO-2 / alivin 1 clonación del ADN o clonación génica(vector de clonación)HG13735-UT$215
     Más información sobre los vectores de expresión
    Product nameProduct name

    AMIGO2 contains Ig-like C2-type (immunoglobulin-like) domain, 6 LRR (leucine-rich) repeats, 1 LRRCT domain and 1 LRRNT domain. It belongs to the immunoglobulin superfamily, AMIGO family. AMIGO2 may mediate homophilic as well as heterophilic cell-cell interaction with AMIGO1 or AMIGO3. It is required for depolarization-dependent survival of cultured cerebellar granule neurons. AMIGO2 may also contribute to signal transduction through its intracellular domain. It may play a role in the tumorigenesis of a subset of gastric adenocarcinomas. AMIGO2 is highly expressed in breast, ovary, cervix, and uterus.

  • Rouhiainen A, et al. (2003) AMIGO, a transmembrane protein implicated in axon tract development, defines a novel protein family with leucine-rich repeats. J Cell Biol. 160:963-73.
  • Kikkawa Y, et al. (2003) Alivin 1, a novel neuronal activity-dependent gene, inhibits apoptosis and promotes survival of cerebellar granule neurons. J Neurosci. 23:5887-96.
  • Bassi R, et al. (2004) DEGA/AMIGO-2, a leucine-rich repeat family member, differentially expressed in human gastric adenocarcinoma: effects on ploidy, chromosomal stability, cell adhesion/migration and tumorigenicity. Oncogene 23:5056-67.
  • Size / Price
    Catálogo: HG13735-NM
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.