Pedido rápido

Humano Apc5/ANAPC5 clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano ANAPC5 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_016237.4
    Tamaño de cDNA:2268bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens anaphase promoting complex subunit 5.
    Sinónimo de gen:APC5
    Especie:Human
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ANAPC5 qPCR primers for gene expression analysis, HP102872 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Humano Apc5/ANAPC5 clonación del ADN o clonación génica(vector de clonación) on other vectors
    Humano Apc5/ANAPC5 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14222-ACG$245
    Humano Apc5/ANAPC5 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14222-ACR$245
    Humano Apc5/ANAPC5 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14222-ANG$245
    Humano Apc5/ANAPC5 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14222-ANR$245
    Humano Apc5/ANAPC5 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14222-CF$215
    Humano Apc5/ANAPC5 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14222-CH$215
    Humano Apc5/ANAPC5 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14222-CM$215
    Humano Apc5/ANAPC5 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14222-CY$215
    Humano Apc5/ANAPC5 clonación del ADN o clonación génica(Vector de expresión)HG14222-G$75
    Humano Apc5/ANAPC5 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14222-NF$215
    Humano Apc5/ANAPC5 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14222-NH$215
    Humano Apc5/ANAPC5 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14222-NM$215
    Humano Apc5/ANAPC5 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14222-NY$215
    Humano Apc5/ANAPC5 clonación del ADN o clonación génica(Vector de expresión)HG14222-U$75
    Humano Apc5/ANAPC5 clonación del ADN o clonación génica(vector de clonación)HG14222-UT$215
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: HG14222-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"