Pedido rápido

Text Size:AAA

Humano ANKRD10 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human ANKRD10 Información de producto de clon de cDNA
Tamaño de cDNA:663bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens ankyrin repeat domain 10 with N terminal His tag.
Sinónimo de gen:RP11-120J20.3, DKFZp686B07190, FLJ20093, ANKRD10
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano ANKRD10 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano ANKRD10 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14266-ACG$225
Humano ANKRD10 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14266-ACR$225
Humano ANKRD10 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14266-ANG$225
Humano ANKRD10 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14266-ANR$225
Humano ANKRD10 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14266-CF$195
Humano ANKRD10 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14266-CH$195
Humano ANKRD10 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14266-CM$195
Humano ANKRD10 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14266-CY$195
Humano ANKRD10 clonación del ADN o clonación génica(Vector de expresión)HG14266-G$75
Humano ANKRD10 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14266-NF$195
Humano ANKRD10 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14266-NH$195
Humano ANKRD10 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14266-NM$195
Humano ANKRD10 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14266-NY$195
Humano ANKRD10 clonación del ADN o clonación génica(vector de clonación)HG14266-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG14266-NH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.