After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human ANXA5 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001154.3
Tamaño de cDNA:963bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens annexin A5 with C terminal His tag.
Sinónimo de gen:PP4, ANX5, ENX2, ANXA5
Especie:Human
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10448-ACG$225
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10448-ACR$225
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10448-ANG$225
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10448-ANR$225
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10448-CF$195
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10448-CH$195
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10448-CM$195
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10448-CY$195
Humano ANXA5 clonación del ADN o clonación génica(Vector de expresión)HG10448-M$75
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10448-M-F$195
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación)HG10448-M-N$195
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10448-NF$195
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10448-NH$195
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10448-NM$195
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10448-NY$195
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación)HG10448-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Referencias
  • Cederholm A, et al. (2007) Annexin A5 as a novel player in prevention of atherothrombosis in SLE and in the general population. Ann N Y Acad Sci. 1108: 96-103.
  • Schlaepfer DD, et al. (1992) Inhibition of Protein Kinase C by AnnexinⅤ. Biochemistry. 31: 1886-91.
  • Vermes I, et al. (1995) A novel assay for apoptosis-flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled Annexin Ⅴ. J Immunol Methods. 184 (1): 39-51.
  • Size / Price
    Catálogo: HG10448-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"