Pedido rápido

Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Humano ANXA5 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001154.3
Tamaño de cDNA:963bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens annexin A5 with C terminal His tag.
Sinónimo de gen:PP4, ANX5, ENX2, ANXA5
Especie:Human
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ANXA5 qPCR primers for gene expression analysis, HP100477 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10448-ACG$225
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10448-ACR$225
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10448-ANG$225
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10448-ANR$225
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10448-CF$195
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10448-CH$195
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10448-CM$195
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10448-CY$195
Humano ANXA5 clonación del ADN o clonación génica(Vector de expresión)HG10448-M$75
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10448-M-F$195
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación)HG10448-M-N$195
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10448-NF$195
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10448-NH$195
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10448-NM$195
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10448-NY$195
Humano ANXA5 clonación del ADN o clonación génica(vector de clonación)HG10448-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Referencias
  • Cederholm A, et al. (2007) Annexin A5 as a novel player in prevention of atherothrombosis in SLE and in the general population. Ann N Y Acad Sci. 1108: 96-103.
  • Schlaepfer DD, et al. (1992) Inhibition of Protein Kinase C by AnnexinⅤ. Biochemistry. 31: 1886-91.
  • Vermes I, et al. (1995) A novel assay for apoptosis-flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled Annexin Ⅴ. J Immunol Methods. 184 (1): 39-51.
  • Size / Price
    Catálogo: HG10448-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"