Pedido rápido

Text Size:AAA

Humano Annexin VI/ANXA6 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human ANXA6 Información de producto de clon de cDNA
Tamaño de cDNA:2022bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens annexin A6 with N terminal HA tag.
Sinónimo de gen:ANX6; CBP68
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano Annexin VI/ANXA6 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
Humano Annexin VI/ANXA6 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11161-ACG$245
Humano Annexin VI/ANXA6 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11161-ACR$245
Humano Annexin VI/ANXA6 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11161-ANG$245
Humano Annexin VI/ANXA6 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11161-ANR$245
Humano Annexin VI/ANXA6 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11161-CF$75
Humano Annexin VI/ANXA6 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11161-CH$215
Humano Annexin VI/ANXA6 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11161-CM$215
Humano Annexin VI/ANXA6 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11161-CY$215
Humano Annexin VI/ANXA6 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11161-M-F$215
Humano Annexin VI/ANXA6 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11161-NF$215
Humano Annexin VI/ANXA6 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11161-NH$215
Humano Annexin VI/ANXA6 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11161-NM$215
Humano Annexin VI/ANXA6 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11161-NY$215
Humano Annexin VI/ANXA6 clonación del ADN o clonación génica(Vector de expresión)HG11161-U$75
Humano Annexin VI/ANXA6 clonación del ADN o clonación génica(vector de clonación)HG11161-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

Annexin A6, also known as ANXA6 or ANXAⅥ, belongs to a family of Ca2+-dependent membrane and phospholipid binding proteins. Members of this family have been implicated in membrane-related events along exocytotic and endocytotic pathways. Annexin 6 is phosphorylated in vivo associated with cell growth. Annexin 6 was not phosphorylated in quiescent cells, but was phosphorylated on serine and to a lesser extent threonine, several hours following cell stimulation. Experiment has revealed the presence of annexin A6 on the cell surface of variety cells as putative receptors and / or binding proteins for chondroitin sulfate proteoglycans, helping cells to bind with this extracellular matrix glycosaminoglycan chondroitin sulfate which is related to the cell-substratum adhesion. A post-tranlational modification other than direct protein phosphorylation may influence the activity of annexin6 and provide evidence linking cell growth with regulation of annexin 6 function. 

  • Takagi H, et al. (2002) Annexin 6 is a putative cell surface receptor for chondroitin sulfate chains. J Cell Sci. 115 (16): 3309-18.
  • Moss SE, et al. (1992) A growth-dependent post-translational modification of annexin VI. Biochim Biophys Acta. 1160 (1): 120-6.
  • Song G, et al. (1998) Altered cardiac annexin mRNA and protein levels in the left ventricle of patients with end-stage heart failure. J Mol Cell Cardio. 30 (3): 443-51.
  • Size / Price
    Catálogo: HG11161-NY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.