Pedido rápido

Human AP2M1 natural ORF mammalian expression plasmid

Hoja de datosReseñasProductos relacionadosProtocolos
Human AP2M1 Información de producto de clon de cDNA
Gene_bank_ref_id:BC004996.1
Tamaño de cDNA:1308bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens adaptor-related protein complex 2, mu 1 subunit.
Sinónimo de gen:mu2, AP50, CLAPM1
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-AP2M1
Sitio de restricción:HindIII + NotI (6.1kb + 1.31kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catálogo: HG16144-UT
Precio de lista:   (Save )
Precio:      [How to order]
DisponibilidadIn Stock Instrucciones de envío
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"