Pedido rápido

Humano APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human APEX1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001641.3
Tamaño de cDNA:957bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens APEX nuclease (multifunctional DNA repair enzyme) 1.
Sinónimo de gen:APE, APX, APE1, APEN, APEX, HAP1, REF1
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG16161-ACG$225
Humano APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG16161-ACR$225
Humano APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG16161-ANG$225
Humano APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG16161-ANR$225
Humano APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG16161-CF$195
Humano APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG16161-CH$195
Humano APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG16161-CM$195
Humano APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG16161-CY$195
Humano APEX1/APE1/Ref-1 clonación del ADN o clonación génica(Vector de expresión)HG16161-G$75
Humano APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG16161-NF$195
Humano APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG16161-NH$195
Humano APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG16161-NM$195
Humano APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG16161-NY$195
Humano APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación)HG16161-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

The enzyme is known to be a redox factor (Ref-1) stimulating DNA binding activity of AP-1 binding proteins such as Fos and Jun as well as a multifunctional DNA repair enzyme having 5' AP endonuclease, DNA 3' repair diesterase, 3'-5' exonuclease and DNA 3'-phosphatase activities.Although Apex mRNA was expressed ubiquitously, the levels varied significantly, suggesting organ- or tissue-specific expression of the Apex gene. The highest level was observed in the testis, relatively high levels in the thymus, spleen, kidney and brain, and the lowest level in the liver in rats. However, the present results suggested that APEX/Ref-1 gene product can interact with AP-1 binding proteins in brain, especially in the hippocampal formation, to regulate some brain functions by redox-activation.

Referencias
  • Ono Y, et al. (1995) Developmental expression of APEX nuclease, a multifunctional DNA repair enzyme, in mouse brains. Brain Res Dev Brain Res.86 (1-2): 1-6.
  • Tan Y, et al. (1996) cDNA cloning of rat major AP endonuclease (APEX nuclease) and analyses of its mRNA expression in rat tissues. Acta Med Okayama. 50 (1): 53-60.
  • Yao M, et al. (1999) Genomic structure of the rat major AP endonuclease gene (Apex) with an adjacent putative O-sialoglycoprotease gene (Prsmg1/Gcpl1) and a processed Apex pseudogene (Apexp1). Acta Med Okayama. 53 (6): 245-52.
  • Size / Price
    Catálogo: HG16161-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"