After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano Amphiregulin / AREG clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human AREG Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001657.2
Tamaño de cDNA:2073 bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens amphiregulin with N terminal Flag tag.
Sinónimo de gen:AR,AREGB,CRDGF,SDGF
Especie:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:pCMV3-BMX-Myc
Sitio de restricción:KpnI + NotI(6kb+2.07kb)
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano Amphiregulin / AREG clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Humano Amphiregulin / AREG clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10558-ACG$225
Humano Amphiregulin / AREG clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10558-ACR$225
Humano Amphiregulin / AREG clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10558-CF$195
Humano Amphiregulin / AREG clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10558-CH$195
Humano Amphiregulin / AREG clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10558-CM$195
Humano Amphiregulin / AREG clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10558-CY$195
Humano Amphiregulin / AREG clonación del ADN o clonación génica(Vector de expresión)HG10558-M$75
Humano Amphiregulin / AREG clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10558-M-F$195
Humano Amphiregulin / AREG clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10558-NF$215
Humano Amphiregulin / AREG clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10558-NH$195
Humano Amphiregulin / AREG clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10558-NM$195
Humano Amphiregulin / AREG clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10558-NY$195
Humano Amphiregulin / AREG clonación del ADN o clonación génica(vector de clonación)HG10558-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Amphiregulin(AREG), also known as colorectum cell-derived growth factor, CRDGF, SDGF and AREG, is a member of the epidermal growth factor family and the amphiregulin family. Members of EGF family are cytokines that include 10 proteins such as EGF, TGFb, HBEGF, and the various heregulins. Amphiregulin is a single-pass membrane protein and contains one EGF-like domain. It plays a key role in epithelial development in various organs. Amphiregulin has a realationship with epidermal growth factor (EGF) and transforming growth factor alpha (TGF-alpha). It is an autocrine growth factor as well as a mitogen for astrocytes, Schwann cells, and fibroblasts. As a bifunctional growth-modulating glycoprotein, amphiregulin inhibits growth of several human carcinoma cells in culture and stimulates proliferation of human fibroblasts and certain other tumor cells. Amphiregulin also may play a protective role in bleomycin-induced pneumopathy, probably through the activation of survival signals.

Referencias
  • Shoyab M, et al. (1989) Structure and function of human amphiregulin: a member of the epidermal growth factor family. Science. 243 (4894): 1074-6.
  • Plowman GD, et al. (1990) The amphiregulin gene encodes a novel epidermal growth factor-related protein with tumor-inhibitory activity. Mol Cell Biol. 10 (5): 1969-81.
  • Culouscou JM, et al. (1993) Colorectum cell-derived growth factor (CRDGF) is homologous to amphiregulin, a member of the epidermal growth factor family. Growth Factors. 7 (3): 195-205.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"