Pedido rápido

Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano ARRB1 Información de producto de clon de cDNA
    Tamaño de cDNA:1257bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens arrestin, beta 1 with N terminal His tag.
    Sinónimo de gen:ARB1, ARR1, ARRB1
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    ( We provide with ARRB1 qPCR primers for gene expression analysis, HP101914 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
    Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG12310-ACG$225
    Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG12310-ACR$225
    Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG12310-ANG$225
    Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG12310-ANR$225
    Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG12310-CF$195
    Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG12310-CH$195
    Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG12310-CM$195
    Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG12310-CY$195
    Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(Vector de expresión)HG12310-G$75
    Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG12310-NF$195
    Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG12310-NH$195
    Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG12310-NM$195
    Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG12310-NY$195
    Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación)HG12310-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: HG12310-NH
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.