After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human ARRB1 Información de producto de clon de cDNA
Gene_bank_ref_id:BC003636
Tamaño de cDNA:1257bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens arrestin, beta 1 with N terminal His tag.
Sinónimo de gen:ARB1, ARR1, ARRB1
Especie:Human
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG12310-ACG$225
Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG12310-ACR$225
Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG12310-ANG$225
Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG12310-ANR$225
Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG12310-CF$195
Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG12310-CH$195
Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG12310-CM$195
Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG12310-CY$195
Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(Vector de expresión)HG12310-G$75
Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG12310-NF$195
Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG12310-NH$195
Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG12310-NM$195
Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG12310-NY$195
Humano beta Arrestin 1/ARRB1 clonación del ADN o clonación génica(vector de clonación)HG12310-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"