Pedido rápido

Humano Arylsulfatase A / ARSA clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano ARSA Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_000487.4
    Tamaño de cDNA:1524bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens arylsulfatase A with C terminal His tag.
    Sinónimo de gen:MLD, ARSA
    Especie:Human
    Vector:pCMV3-C-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ARSA qPCR primers for gene expression analysis, HP100478 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Humano Arylsulfatase A / ARSA clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
    Humano Arylsulfatase A / ARSA clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10449-ACG$245
    Humano Arylsulfatase A / ARSA clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10449-ACR$245
    Humano Arylsulfatase A / ARSA clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10449-CF$215
    Humano Arylsulfatase A / ARSA clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10449-CH$215
    Humano Arylsulfatase A / ARSA clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10449-CM$215
    Humano Arylsulfatase A / ARSA clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10449-CY$215
    Humano Arylsulfatase A / ARSA clonación del ADN o clonación génica(Vector de expresión)HG10449-M$75
    Humano Arylsulfatase A / ARSA clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10449-M-F$215
    Humano Arylsulfatase A / ARSA clonación del ADN o clonación génica(vector de clonación)HG10449-M-N$215
    Humano Arylsulfatase A / ARSA clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10449-NF$215
    Humano Arylsulfatase A / ARSA clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10449-NH$215
    Humano Arylsulfatase A / ARSA clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10449-NM$215
    Humano Arylsulfatase A / ARSA clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10449-NY$215
    Humano Arylsulfatase A / ARSA clonación del ADN o clonación génica(vector de clonación)HG10449-UT$215
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    Arylsulfatase A (ARSA) is synthesized as a 52KDa lysosomal enzyme. It is a member of the sulfatase family that is required for the lysosomal degradation of cerebroside-3-sulfate, a sphingolipid sulfate ester and a major constituent of the myelin sheet. Arylsulfatase A is activated by a required co- or posttranslational modification with the oxidation of cysteine to formylglycine. Metachromatic leukodystrophy (MLD) is a lysosomal storage disease in the central and peripheral nervous systems with severe and progressive neurological symptoms caused by the deficiency of Arylsulfatase A. Deficiency of this enzyme is also found in apparently healthy individuals, a condition for which the term pseudodeficiency is introduced. ARSA forms dimers after receiving three N-linked oligosaccharides in the endoplasmic reticulum, and then the dimers are transported to the Golgi where they receive mannose 6-phosphate recognition markers. And thus, ARSA is transported and delivered to dense lysosomes in a mannose 6-phosphate receptor-dependent manner. It has been shown that within the lysosomes, the ARSA dimers can oligomerize to an octamer in a pH-dependent manner. The ARSA deficiency leads to metachromatic leucodystrophy (MLD), a lysosomal storage disorder associated with severe and progressive demyelination in he central and peripheral nervous system. Additionally, the serum level of arylsulfatase A might be helpful in diagnosis of lung and central nervous system cancer.

    Referencias
  • Laidler PM. (1991) Arylsulfatase A--physico-chemical properties and the use of enzyme radioimmunoassay in medical diagnosis Folia Med Cracov. 32(3-4): 149-68.
  • Jean S, et al. (2006) Ethanol decreases rat hepatic arylsulfatase A activity levels. Alcohol Clin Exp Res. 30(11): 1950-5.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"