After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Human ARSB ORF mammalian expression plasmid, N-His tag

Hoja de datosReferencias específicasReseñasProductos relacionadosProtocolos
ARSBInformación de producto de clon de cDNA
Gene_bank_ref_id:NM_000046.3
Tamaño de cDNA:1602bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens arylsulfatase B with N terminal His tag.
Sinónimo de gen:ASB, G4S, MPS6, ARSB
Especie:Human
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Other ARSB Protein Products
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Size / Price
Catálogo:HG13674-NH
Precio de lista: $315.00  (Save $0.00)
Precio:$315.00      [How to order]
N2-3 weeks
Imágenes
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"