ATP6V1F cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

ATP6V1F cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
360 bp
Description
Full length Clone DNA of Human ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ATP6V1F cDNA ORF Clone, Human, C-HA tag: Alternative Names

ATP6S14 cDNA ORF Clone, Human; VATF cDNA ORF Clone, Human; Vma7 cDNA ORF Clone, Human

ATP6V1F Background Information

ATP6V1F encodes a component of vacuolar ATPase mediating acidification. The cDNA and the genomic sequences of ATP6V1F were cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription polymerase chain reaction and touchdown-polymerase chain reaction, respectively. Topology prediction showed that there is one protein kinase C phosphorylation site, two Casein kinase II phosphorylation sites, and one N-myristoylation site in the ATP6V1F protein. Up-regulated expression of mammary tumor 8 kDa protein (MAT-8), complement component C1S (C1S), ferritin heavy chain (FTH1), peptidyl-prolyl cis-trans isomerase A (PPIA), RNA-binding protein regulatory subunit DJ-1 protein (DJ-1) and vacuolar ATP synthase subunit F (ATP6V1F) was determined in prostate carcinoma and confirmed by using quantitative real-time RT-PCR analyses.
Full Name
ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait