After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano Azurocidin / CAP37 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human AZU1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001700.3
Tamaño de cDNA:756bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens azurocidin 1.
Sinónimo de gen:AZU, HBP, NAZC, AZAMP, CAP37, HUMAZUR, AZU1
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-AZU1
Sitio de restricción:KpnI + XbaI (6.1kb + 0.76kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 165C>A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human AZU1 Gene Plasmid Map
Human AZU1 / HBP Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano Azurocidin / CAP37 clonación del ADN o clonación génica(vector de clonación) on other vectors
Product nameProduct name
Fondo

Azurocidin (AZU1), also known as heparin-binding protein (HBP) or cationic antimicrobial protein 37 (CAP37), is an azurophil granule antibiotic protein, with monocyte chemotactic and antibacterial activity. The Azurophil granules, specialized lysosomes of the neutrophil, contain at least 10 proteins implicated in the killing of microorganisms. Azurocidin is a member of the serine protease family that includes Cathepsin G, neutrophil elastase (NE), and proteinase 3 (PR3), however, Azurocidin is not a serine proteinase since the active site serine and histidine residues are replaced. Neutrophils arriving first at sites of inflammation release Azurocidin, which acts in a paracrine fashion on endothelial cells causing the development of intercellular gaps and allowing leukocyte extravasation. It thus be regarded as a reasonable therapeutic target for a variety of inflammatory disease conditions.

Referencias
  • Lindmark A, et al. (1999) Characterization of the biosynthesis, processing, and sorting of human HBP/CAP37/azurocidin. J Leukoc Biol. 66(4): 634-43.
  • Heinzelmann M, et al. (2001) Heparin binding protein (CAP37) differentially modulates endotoxin-induced cytokine production. Int J Surg Investig. 2(6): 457-66.
  • Soehnlein O, et al. (2005) Neutrophil-derived heparin-binding protein (HBP/CAP37) deposited on endothelium enhances monocyte arrest under flow conditions. J Immunol. 174(10): 6399-405.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"