Pedido rápido

Human Apolipoprotein H / APOH ORF mammalian expression plasmid, N-Flag tag

Hoja de datosReseñasProductos relacionadosProtocolos
Human APOH Información de producto de clon de cDNA
Tamaño de cDNA:1038bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens apolipoprotein H (beta-2-glycoprotein I) with N terminal Flag tag.
Sinónimo de gen:BG, B2G1, APOH
Sitio de restricción:KpnI + XbaI (6kb + 1.07kb)
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human APOH Gene Plasmid Map
Human Apolipoprotein H / APOH natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Apolipoprotein H (APOH), also known as Beta-2-glycoprotein 1, Activated protein C-binding protein, B2GPI, and B2G1, is a glycoprotein synthesized by liver cells and it is present in the blood associated with plasma lipoproteins. It is an essential cofactor for the binding of certain antiphospholipid antibodies (APA) to anionic phospholipid. APOH binds to various kinds of negatively charged substances such as heparin, phospholipids, and dextran sulfate. APOH may prevent activation of the intrinsic blood coagulation cascade by binding to phospholipids on the surface of damaged cells. APOH appears to completely inhibit serotonin release by the platelets and prevents subsequent waves of the ADP-induced aggregation. The activity of APOH appears to involve the binding of agglutenating, negatively charged compounds, and inhibits agglutenation by the contact activation of the intrinsic blood coagulation pathway. APOH causes a reduction of the prothrombinase binding sites on platelets and reduces the activation caused by collagen when thrombin is present at physiological serum concentrations of APOH suggesting a regulatory role of APOH in coagulation. APOH plasma concentrations are strongly associated to metabolic syndrome alterations and vascular disease in type 2 diabetic and could be considered as a clinical marker of cardiovascular risk. APOH is found on several classes of lipoproteins, and is involved in the activation of lipoprotein lipase in lipid metabolism. This single-chain glycoprotein also has been implicated in several physiologic pathways including coagulation and the production of hypertension, which are related to the pathogenesis of primary cerebral hemorrhage (PICH).

  • Kamboh MI, et al. (1998) Genetics of apolipoprotein H (beta2-glycoprotein I) and anionic phospholipid binding. Lupus. 7 Suppl 2: S10-3.
  • Singh P, et al. (2002) Genetics of apolipoprotein H (beta2-glycoprotein I) polymorphism in India. Ann Hum Biol. 29(3): 247-55.
  • Xia J, et al. (2004) Apolipoprotein H gene polymorphisms and risk of primary cerebral hemorrhage in a Chinese population. Cerebrovasc Dis. 17(2-3): 197-203.
  • Chen Q, et al. (2006) Complete DNA sequence variation in the apolipoprotein H (beta-glycoprotein I) gene and identification of informative SNPs. Ann Hum Genet. 70(Pt 1): 1-11.
  • Leduc MS, et al. (2008) Comprehensive evaluation of apolipoprotein H gene (APOH) variation identifies novel associations with measures of lipid metabolism in GENOA. J Lipid Res. 49(12): 2648-56.
  • Size / Price
    Catálogo: HG11221-NF
    Precio de lista:   (Save )
    Precio:      [How to order]
    DisponibilidadIn StockInstrucciones de envío
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.