After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Humano BCL2L1/Bcl-XL clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human BCL2L1 Información de producto de clon de cDNA
Tamaño de cDNA:702bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens BCL2-like 1 with C terminal His tag.
Sinónimo de gen:BCLX, BCL2L, Bcl-X, bcl-xL, bcl-xS, BCL-XL/S, DKFZp781P2092, BCL2L1
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano BCL2L1/Bcl-XL clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano BCL2L1/Bcl-XL clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10455-ACG$225
Humano BCL2L1/Bcl-XL clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10455-ACR$225
Humano BCL2L1/Bcl-XL clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10455-ANG$225
Humano BCL2L1/Bcl-XL clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10455-ANR$225
Humano BCL2L1/Bcl-XL clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10455-CF$195
Humano BCL2L1/Bcl-XL clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10455-CH$195
Humano BCL2L1/Bcl-XL clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10455-CM$195
Humano BCL2L1/Bcl-XL clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10455-CY$195
Humano BCL2L1/Bcl-XL clonación del ADN o clonación génica(Vector de expresión)HG10455-M$75
Humano BCL2L1/Bcl-XL clonación del ADN o clonación génica(vector de clonación)HG10455-M-N$195
Humano BCL2L1/Bcl-XL clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10455-NF$195
Humano BCL2L1/Bcl-XL clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10455-NH$195
Humano BCL2L1/Bcl-XL clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10455-NM$195
Humano BCL2L1/Bcl-XL clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10455-NY$195
Humano BCL2L1/Bcl-XL clonación del ADN o clonación génica(vector de clonación)HG10455-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

B-cell lymphoma-extra large (Bcl-xl) is a transmembrane molecule in the mitochondria. Bcl-xL (BCL2L1) , belongs to the Bcl-2 family. Members of the bcl-2 family encode proteins that function either to promote or to inhibit apoptosis. Antiapoptotic members such as Bcl-2 and Bcl-xL prevent PCD in response to a wide variety of stimuli to take part in cancer survival. Conversely, proapoptotic proteins, exemplified by Bax and Bak, can accelerate death and in some instances are sufficient to cause apoptosis independent of additional signals. The crystal and solution structures of a Bcl-2 family member, Bcl-xL is like this: The structures consist of two central, primarily hydrophobic α-helices, which are surrounded by amphipathic helices. A 60-residue loop connecting helices αl and α2 was found to be flexible and non-essential for anti-apoptotic activity. Bcl-xL is chareacterized as important factors in autophagy, inhibiting Beclin 1-mediated autophagy by binding to Beclin 1. In addition, Beclin 1, Bcl-2 and Bcl-xL can cooperate with Atg5 or Ca2+ to regulate both autophagy and apoptosis. Bcl-xL is also implicated in anoxia induced cell death. The pathway is initiated by the loss of function of the prosurvival Bcl-2 family members Mcl-1 and Bcl-2 / Bcl-XL, resulting in Bax- or Bak-dependent release of cytochrome c and subsequent caspase-9-dependent cell death. Thus, Bcl-xL, the well-characterized apoptosis guards, appears to be important in cell death.

  • Vander Heiden MG, et al. (1997) Bcl-xL Regulates the Membrane Potential and Volume Homeostasis of Mitochondria. Cell. 91 (5): 627-37.
  • Muchmore SW, et al. (1996) X-ray and NMR structure of human Bcl-xL, an inhibitor of programmed cell death. Nature. 381: 335-341.
  • SharoffEH, et al. (2007) Bcl-2 family members regulate anoxia-induced cell death. Antioxid Redox Signal. 9 (9) :1405-9.
  • Zhou F, et al. (2011) Bcl-2 and Bcl-xL play important roles in the crosstalk between autophagy and apoptosis. FEBS J. 278 (3): 403-13.
  • Size / Price
    Catálogo: HG10455-CH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.