BFSP2 cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

BFSP2 cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1248 bp
Description
Full length Clone DNA of Human beaded filament structural protein 2, phakinin with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

BFSP2 cDNA ORF Clone, Human, C-HA tag: Alternative Names

CP47 cDNA ORF Clone, Human; CP49 cDNA ORF Clone, Human; CTRCT12 cDNA ORF Clone, Human; LIFL-L cDNA ORF Clone, Human; PHAKOSIN cDNA ORF Clone, Human

BFSP2 Background Information

Full Name
beaded filament structural protein 2, phakinin
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait