After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Human BIN2 natural ORF mammalian expression plasmid

Hoja de datosReseñasProductos relacionadosProtocolos
Human BIN2 Información de producto de clon de cDNA
Gene_bank_ref_id:BC047686
Tamaño de cDNA:1698bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens bridging integrator 2 DNA.
Sinónimo de gen:BRAP-1
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catálogo: HG15226-UT
Precio de lista:   (Save )
Precio:      [How to order]
Disponibilidad2-3 weeks
 Instrucciones de envío
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"