After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano BPHL clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human BPHL Información de producto de clon de cDNA
Gene_bank_ref_id:BC106901
Tamaño de cDNA:825bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens biphenyl hydrolase-like (serine hydrolase) with C terminal His tag.
Sinónimo de gen:MCNAA, BPH-RP, VACVASE
Especie:Human
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Fondo

BPHL is a member of the serine protease family. BPHL is expressed large quantities in liver and kidney and in minor quantities in heart, intestine and skeletal muscle. BPHL is a specific alpha-amino acid ester hydrolase that prefers small, hydrophobic, and aromatic side chains and does not have a stringent requirement for the leaving group other than preferring a primary alcohol. It catalyzes the hydrolytic activation of amino acid ester prodrugs of nucleoside analogs such as valacyclovir and valganciclovir. BPHL also activates valacyclovir to acyclovir. It may play a role in detoxification processes.

Referencias
  • Lai L. et al., 2008, J Biol Chem. 283 (14): 9318-27.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Hendrickson SL. et al., 2010, PLoS One. 5 (9): e12862.
  • Size / Price
    Catálogo: HG15763-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"