Pedido rápido

Humano Biglycan clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano BGN Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_001711.3
    Tamaño de cDNA:1107bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens biglycan with C terminal His tag.
    Sinónimo de gen:PGI, DSPG1, PG-S1, SLRR1A, BGN
    Especie:Human
    Vector:pCMV3-C-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with BGN qPCR primers for gene expression analysis, HP100476 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Fondo

    Biglycan, also known as PG-S1 and BGN, is a a small leucine-rich repeat proteoglycan (SLRP). It can be detected in a variety of extracellular matrix tissues, including bone, cartilage and tendon. Biglycan consists of a protein core containing leucine-rich repeat regions and two glycosaminoglycan (GAG) chains consisting of either chondroitin sulfate (CS) or dermatan sulfate (DS). Non-glycanated forms of biglycan (no GAG chains) increase with age in human articular cartilage. Biglycan interacts with collagen, both via the core protein and GAG chains. Biglycan plays a role in the mineralisation of bone. Biglycan core protein binds to the growth factors BMP-4 and influences its bioactivity.

    Size / Price
    Catálogo: HG10447-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"