After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano Bruton Tyrosine Kinase / BTK Kinase clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human BTK Información de producto de clon de cDNA
Gene_bank_ref_id:NM_000061.2
Tamaño de cDNA:1980bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens Bruton agammaglobulinemia tyrosine kinase with C terminal Myc tag.
Sinónimo de gen:AT, ATK, BPK, XLA, IMD1, AGMX1, PSCTK1, MGC126261, MGC126262
Especie:Human
Vector:pCMV3-C-Myc
Plasmid:pCMV3-BTK-Myc
Sitio de restricción:KpnI + NotI (6kb + 2.03kb)
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1899C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human BTK Gene Plasmid Map
Human Bruton Tyrosine Kinase / BTK Kinase ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano Bruton Tyrosine Kinase / BTK Kinase clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Humano Bruton Tyrosine Kinase / BTK Kinase clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10578-ACG$245
Humano Bruton Tyrosine Kinase / BTK Kinase clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10578-ACR$245
Humano Bruton Tyrosine Kinase / BTK Kinase clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10578-ANG$245
Humano Bruton Tyrosine Kinase / BTK Kinase clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10578-ANR$245
Humano Bruton Tyrosine Kinase / BTK Kinase clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10578-CF$215
Humano Bruton Tyrosine Kinase / BTK Kinase clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10578-CH$215
Humano Bruton Tyrosine Kinase / BTK Kinase clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10578-CM$215
Humano Bruton Tyrosine Kinase / BTK Kinase clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10578-CY$215
Humano Bruton Tyrosine Kinase / BTK Kinase clonación del ADN o clonación génica(Vector de expresión)HG10578-M$75
Humano Bruton Tyrosine Kinase / BTK Kinase clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10578-NF$215
Humano Bruton Tyrosine Kinase / BTK Kinase clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10578-NH$215
Humano Bruton Tyrosine Kinase / BTK Kinase clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10578-NM$215
Humano Bruton Tyrosine Kinase / BTK Kinase clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10578-NY$215
Humano Bruton Tyrosine Kinase / BTK Kinase clonación del ADN o clonación génica(vector de clonación)HG10578-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Bruton's tyrosine kinase (or BTK) is a type of kinase protein expressed in B lymphocytes and T cells. BTK contains a PH domain which binds phosphatidylinositol(3,4,5)-trisphosphate (PIP3). After binding to PIP3, BTK is induced to phosphorylate phospholipase C, which in turn hydrolyzes PIP2 into two second messagers, IP3 and DAG, which then modulate the activity of downstream proteins during B-cell signaling. Btk is also found implicated in the primary immunodeficiency disease X-linked agammaglobulinemia(Bruton's agammaglobulinemia). BTK played a key role in B-cell maturation as well as mast cell activation through the high-affinity IgE receptor. Patients with X-linked agammaglobulinemia have normal pre-B cell populations in their bone marrow but these B-cells can not mature and enter the circulation.

Referencias
  • Hashimoto S, et al. (1996) Identification of Bruton's tyrosine kinase (Btk) gene mutations and characterization of the derived proteins in 35 X-linked agammaglobulinemia families: a nationwide study of Btk deficiency in Japan. Blood. 88(2): 561-73.
  • Ohta Y, et al. (1994) Genomic organization and structure of Bruton agammaglobulinemia tyrosine kinase: localization of mutations associated with varied clinical presentations and course in X chromosome-linked agammaglobulinemia. PNAS. 91(19): 9062-6.
  • Smith C, et al. (1994) Expression of Bruton's agammaglobulinemia tyrosine kinase gene, BTK, is selectively down-regulated in T lymphocytes and plasma cells. The Journal of Immunology. 152(2): 557-65.
  • Size / Price
    Catálogo: HG10578-CM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"