Pedido rápido

Humano C11ORF82 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human C11ORF82 Información de producto de clon de cDNA
Tamaño de cDNA:2997bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens chromosome 11 open reading frame 82 with C terminal His tag.
Sinónimo de gen:noxin, C11orf82
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano C11ORF82 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano C11ORF82 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG13383-ACG$325
Humano C11ORF82 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG13383-ACR$325
Humano C11ORF82 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG13383-ANG$325
Humano C11ORF82 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG13383-ANR$325
Humano C11ORF82 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG13383-CF$295
Humano C11ORF82 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG13383-CH$295
Humano C11ORF82 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG13383-CM$295
Humano C11ORF82 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG13383-CY$295
Humano C11ORF82 clonación del ADN o clonación génica(Vector de expresión)HG13383-G$75
Humano C11ORF82 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG13383-NF$295
Humano C11ORF82 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG13383-NH$295
Humano C11ORF82 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG13383-NM$295
Humano C11ORF82 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG13383-NY$295
Humano C11ORF82 clonación del ADN o clonación génica(vector de clonación)HG13383-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG13383-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.