Pedido rápido

Humano Complement Component C2 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Humano C2 Información de producto de clon de cDNA
Tamaño de cDNA:2259bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens complement component 2 with N terminal Myc tag.
Sinónimo de gen:C2, CO2, DKFZp779M0311
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
( We provide with C2 qPCR primers for gene expression analysis, HP100224 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano Complement Component C2 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Humano Complement Component C2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10154-ACG$245
Humano Complement Component C2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10154-ACR$245
Humano Complement Component C2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10154-CF$215
Humano Complement Component C2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10154-CH$215
Humano Complement Component C2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10154-CM$215
Humano Complement Component C2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10154-CY$215
Humano Complement Component C2 clonación del ADN o clonación génica(Vector de expresión)HG10154-M$75
Humano Complement Component C2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10154-M-F$215
Humano Complement Component C2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10154-NF$215
Humano Complement Component C2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10154-NH$215
Humano Complement Component C2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10154-NM$215
Humano Complement Component C2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10154-NY$215
Humano Complement Component C2 clonación del ADN o clonación génica(vector de clonación)HG10154-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

Complement component C2 is part of the classical complement pathway which plays a major role in innate immunity against infection. C2 is a glycoprotein synthesized in liver hepatocytes and several other cell types in extrahepatic tissues. This pathway is triggered by a multimolecular complex C1, and subsequently the single-chain form of C2 is cleaved into two chains referred to C2a and C2b by activated C1. The second component of complement (C2) is a multi-domain serine protease that provides catalytic activity for the C3 and C5 convertases of the classical and lectin pathways of human complement. C4b and C2 was investigated by surface plasmon resonance. C2a containing a serine protease domain combines with complement component C4b to form the C3 convertase C4b2a which is responsible for C3 activation, and leads to the stimulation of adaptive immune responses via Lectin pathway. C2 bound to C4b is cleaved by classical (C1s) or lectin (MASP2) proteases to produce C4bC2a. C2 has the same serine protease domain as C4bC2a but in an inactive zymogen-like conformation, requiring cofactor-induced conformational change for activity. Deficiency of C2 (C2D) is the most common genetic deficiency of the complement system, and two types of C2D have been recognized in the context of specific MHC haplotypes. C2D in human is reported to increase susceptibility to infection, and is associated with certain autoimmune diseases, such as rheumatological disorders.

  • Laich A, et al. (2002) Complement C4bC2 complex formation: an investigation by surface plasmon resonance. Biochim Biophys Acta. 1544(1-2): 96-112.
  • Halili MA, et al. (2009) Complement component C2, inhibiting a latent serine protease in the classical pathway of complement activation. Biochemistry. 48(35): 8466-72.
  • Krishnan V, et al. (2009) The structure of C2b, a fragment of complement component C2 produced during C3 convertase formation. Acta Crystallogr D Biol Crystallogr. 65(Pt 3): 266-74.
  • Size / Price
    Catálogo: HG10154-NM
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.