After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano Carbonic Anhydrase IX/CA9 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CA9 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001216.2
Tamaño de cDNA:1380bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens carbonic anhydrase IX with N terminal His tag.
Sinónimo de gen:CA9, MN, CAIX
Especie:Human
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano Carbonic Anhydrase IX/CA9 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano Carbonic Anhydrase IX/CA9 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10107-ACG$225
Humano Carbonic Anhydrase IX/CA9 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10107-ACR$225
Humano Carbonic Anhydrase IX/CA9 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10107-ANG$225
Humano Carbonic Anhydrase IX/CA9 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10107-ANR$225
Humano Carbonic Anhydrase IX/CA9 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10107-CF$195
Humano Carbonic Anhydrase IX/CA9 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10107-CH$195
Humano Carbonic Anhydrase IX/CA9 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10107-CM$195
Humano Carbonic Anhydrase IX/CA9 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10107-CY$195
Humano Carbonic Anhydrase IX/CA9 clonación del ADN o clonación génica(Vector de expresión)HG10107-M$75
Humano Carbonic Anhydrase IX/CA9 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10107-NF$195
Humano Carbonic Anhydrase IX/CA9 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10107-NH$195
Humano Carbonic Anhydrase IX/CA9 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10107-NM$195
Humano Carbonic Anhydrase IX/CA9 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10107-NY$195
Humano Carbonic Anhydrase IX/CA9 clonación del ADN o clonación génica(vector de clonación)HG10107-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Carbonic anhydrases IX (CA IX), also known as membrane antigen MN or CA9, is a member of the carbonic anhydrase (CA) family and may be involved in cell proliferation and cellular transformation. CAs are zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide (H2O + CO2 = H+ + HCO3–) and thus participate in a variety of biological and physical processes. CA IX protein is expressed primarily in carcinoma cells lines, and the expression is cell density dependent and has been shown to be strongly induced by hypoxia, accordingly facilitates adaptation of tumor cells to hypoxic conditions. It is involved in tumorigenesis through many pathways, such as pH regulation and cell adhesion control. CA IX is used as a marker of tumor hypoxia and as a new therapeutic target for many human carcinomas and cancers.

Referencias
  • Loncaster JA, et al. (2001) Carbonic anhydrase (CA IX) expression, a potential new intrinsic marker of hypoxia: correlations with tumor oxygen measurements and prognosis in locally advanced carcinoma of the cervix. Cancer Res. 61(17): 6394-9.
  • Zvada J, et al. (2003) Soluble form of carbonic anhydrase IX (CA IX) in the serum and urine of renal carcinoma patients. Br J Cancer. 89(6): 1067-71.
  • Pan P, et al. (2006) Carbonic anhydrase gene expression in CA II-deficient (Car2-/-) and CA IX-deficient (Car9-/-) mice. J Physiol. 571(Pt 2): 319-27.
  • Zhou GX, et al. (2010) Quantification of carbonic anhydrase IX expression in serum and tissue of renal cell carcinoma patients using enzyme-linked immunosorbent assay: prognostic and diagnostic potentials. Urology. 75(2): 257-61.
  • Size / Price
    Catálogo: HG10107-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"