Pedido rápido

Humano Carbonic Anhydrase XIII/CA13 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CA13 Información de producto de clon de cDNA
Tamaño de cDNA:789bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens carbonic anhydrase XIII with C terminal His tag.
Sinónimo de gen:CAXIII, FLJ37995, MGC59868, CA13
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano Carbonic Anhydrase XIII/CA13 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano Carbonic Anhydrase XIII/CA13 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10461-ACG$225
Humano Carbonic Anhydrase XIII/CA13 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10461-ACR$225
Humano Carbonic Anhydrase XIII/CA13 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10461-ANG$225
Humano Carbonic Anhydrase XIII/CA13 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10461-ANR$225
Humano Carbonic Anhydrase XIII/CA13 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10461-CF$195
Humano Carbonic Anhydrase XIII/CA13 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10461-CH$195
Humano Carbonic Anhydrase XIII/CA13 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10461-CM$195
Humano Carbonic Anhydrase XIII/CA13 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10461-CY$195
Humano Carbonic Anhydrase XIII/CA13 clonación del ADN o clonación génica(Vector de expresión)HG10461-M$75
Humano Carbonic Anhydrase XIII/CA13 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10461-M-F$195
Humano Carbonic Anhydrase XIII/CA13 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10461-NF$195
Humano Carbonic Anhydrase XIII/CA13 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10461-NH$195
Humano Carbonic Anhydrase XIII/CA13 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10461-NM$195
Humano Carbonic Anhydrase XIII/CA13 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10461-NY$195
Humano Carbonic Anhydrase XIII/CA13 clonación del ADN o clonación génica(vector de clonación)HG10461-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. The CAXIII is a member of the CA family, which owns a globular molecule with high structural similarity to cytosolic isozymes, CAI, II, and III. Recombinant mouse CAXIII showed catalytic activity similar to those of mitochondrial CAV and cytosolic CAI. In human tissues, CAXIII expression was identified in the thymus, small intestine, spleen, prostate, ovary, colon, and testis. In mouse, positive tissues included the spleen, lung, kidney, heart, brain, skeletal muscle, and testis. In conclusion, the predicted amino acid sequence, structural model, distribution, and activity data suggest that CAXIII represents a novel enzyme, which may play important physiological roles in several organs.

  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Size / Price
    Catálogo: HG10461-CH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.