After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano Carbonic Anhydrase XIV clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CA14 Información de producto de clon de cDNA
Gene_bank_ref_id:XM_005245060.1
Tamaño de cDNA:960bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens carbonic anhydrase XIV with C terminal His tag.
Sinónimo de gen:CAXiV
Especie:Human
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano Carbonic Anhydrase XIV clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano Carbonic Anhydrase XIV clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10458-ACG$225
Humano Carbonic Anhydrase XIV clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10458-ACR$225
Humano Carbonic Anhydrase XIV clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10458-CF$195
Humano Carbonic Anhydrase XIV clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10458-CH$195
Humano Carbonic Anhydrase XIV clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10458-CM$195
Humano Carbonic Anhydrase XIV clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10458-CY$195
Human CA XIV Gene cDNA clone plasmidHG10458-M$95
Humano Carbonic Anhydrase XIV clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10458-NF$195
Humano Carbonic Anhydrase XIV clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10458-NH$195
Humano Carbonic Anhydrase XIV clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10458-NM$195
Humano Carbonic Anhydrase XIV clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10458-NY$195
Humano Carbonic Anhydrase XIV clonación del ADN o clonación génica(Vector de expresión)HG10458-U$75
Humano Carbonic Anhydrase XIV clonación del ADN o clonación génica(vector de clonación)HG10458-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. CAXIV is a member of CA family that showed an overall similarity of 29–46% to other active CA isozymes. The highest percentage similarity was with a transmembrane CA isoform, CAXII. The CAXIV was found high concentrations in human heart, brain, liver, and skeletal muscle but lower in the colon, small intestine, urinary bladder, and kidney. No CAXIV mRNA was seen in the salivary gland and pancreas. CAXIV is a likely candidate for the extracellular CA postulated to have an important role in modulating excitatory synaptic transmission in brain.

Referencias
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Parkkila S, et al. (2001) Expression of membrane-associated carbonic anhydrase XIV on neurons and axons in mouse and human brain. PNAS. 98(4): 1918-23.
  • Size / Price
    Catálogo: HG10458-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"