After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano Carbonic Anhydrase VA/CA5A clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CA5A Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001739.1
Tamaño de cDNA:918bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens carbonic anhydrase VA, mitochondrial with C terminal HA tag.
Sinónimo de gen:CA5, CAV, CAVA
Especie:Human
Vector:pCMV3-C-HA
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano Carbonic Anhydrase VA/CA5A clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
Humano Carbonic Anhydrase VA/CA5A clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10500-ACG$225
Humano Carbonic Anhydrase VA/CA5A clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10500-ACR$225
Humano Carbonic Anhydrase VA/CA5A clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10500-ANG$225
Humano Carbonic Anhydrase VA/CA5A clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10500-ANR$225
Humano Carbonic Anhydrase VA/CA5A clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10500-CF$195
Humano Carbonic Anhydrase VA/CA5A clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10500-CH$195
Humano Carbonic Anhydrase VA/CA5A clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10500-CM$195
Humano Carbonic Anhydrase VA/CA5A clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10500-CY$195
Humano Carbonic Anhydrase VA/CA5A clonación del ADN o clonación génica(Vector de expresión)HG10500-M$75
Humano Carbonic Anhydrase VA/CA5A clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10500-NF$195
Humano Carbonic Anhydrase VA/CA5A clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10500-NH$195
Humano Carbonic Anhydrase VA/CA5A clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10500-NM$195
Humano Carbonic Anhydrase VA/CA5A clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10500-NY$195
Humano Carbonic Anhydrase VA/CA5A clonación del ADN o clonación génica(vector de clonación)HG10500-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Carbonic anhydrase 5A, mitochondrial, also known as Carbonate dehydratase VA, Carbonic anhydrase VA, CA-VA and CA5A, is a member of the alpha-carbonic anhydrase family. Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes first discovered in 1933 that catalyze the reversible hydration of carbon dioxide. CAs participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. CA5A / CA-VA is activated by histamine, L-adrenaline, L- and D-histidine, and L- and D-phenylalanine. It is inhibited by coumarins, sulfonamide derivatives such as acetazolamide and Foscarnet (phosphonoformate trisodium salt).

Referencias
  • Strausberg, R.L. et al., 2002, Proc. Natl. Acad. Sci. USA 99:16899 - 903.
  • Liao, S.Y. et al., 2003, J. Med. Genet. 40:257 - 262.
  • Temperini C.et al., 2006, Chemistry 12: 7057-66.
  • Temperini C.et al., 2006, J. Med. Chem. 49: 3019-27.
  • Supuran, C. T. et al., 2008, Curr Pharm Des. 14 (7): 601-602.
  • Elleuche, S. et al., 2009, Curr Genet. 55 (2): 211-222.
  • Size / Price
    Catálogo: HG10500-CY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"