After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano CALCB / CGPR / Calcitonin 2 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human CALCB Información de producto de clon de cDNA
Gene_bank_ref_id:NM_000728.3
Tamaño de cDNA:384bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens calcitonin-related polypeptide beta.
Sinónimo de gen:CALC2, CGRP2, CGRP-II, CALCB
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano CALCB / CGPR / Calcitonin 2 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano CALCB / CGPR / Calcitonin 2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG13283-ACG$225
Humano CALCB / CGPR / Calcitonin 2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG13283-ACR$225
Humano CALCB / CGPR / Calcitonin 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG13283-CF$195
Humano CALCB / CGPR / Calcitonin 2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG13283-CH$195
Humano CALCB / CGPR / Calcitonin 2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG13283-CM$195
Humano CALCB / CGPR / Calcitonin 2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG13283-CY$195
Humano CALCB / CGPR / Calcitonin 2 clonación del ADN o clonación génica(Vector de expresión)HG13283-G$75
Humano CALCB / CGPR / Calcitonin 2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG13283-NF$195
Humano CALCB / CGPR / Calcitonin 2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG13283-NH$195
Humano CALCB / CGPR / Calcitonin 2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG13283-NM$195
Humano CALCB / CGPR / Calcitonin 2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG13283-NY$195
Humano CALCB / CGPR / Calcitonin 2 clonación del ADN o clonación génica(vector de clonación)HG13283-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

CALCB, also known as CGPR and calcitonin 2, belongs to the calcitonin family. CALCB is a calcitonin (CT) peptide which may play a role in the mediation of human inflammatory diseases. It is highly expressed in the skin, blood, and cerebrospinal fluid. CGRP immunolabeling (IL) was detected in epidermal keratinocytes at levels that were especially high and widespread in the skin of humans from locations afflicted with postherpetic neuralgia (PHN) and complex region pain syndrome type 1 (CRPS), of monkeys infected with simian immunodeficiency virus, and of rats subjected to L5/L6 spinal nerve ligation, sciatic nerve chronic constriction, and subcutaneous injection of complete Freund's adjuvant. Increased CGRP-IL was also detected in epidermal keratinocytes of transgenic mice with keratin-14 promoter driven overexpression of noggin, an antagonist to BMP-4 signaling. CGPR dilates a variety of vessels including the coronary, cerebral and systemic vasculature.

Referencias
  • Lambert NA. 2008, Sci Signal. 1 (25): re5.
  • Linscheid P. et al., 2005, Endocrinology. 146 (6): 2699-708.
  • Hou Q. et al., 2011, Pain. 152 (9): 2036-51.
  • Size / Price
    Catálogo: HG13283-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad4-5 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"