After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano CaMKII/CAMK2G transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CAMK2G Información de producto de clon de cDNA
Gene_bank_ref_id:NM_172170.3
Tamaño de cDNA:1557bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens calcium/calmodulin-dependent protein kinase II gamma, transcript variant 3 with C terminal His tag.
Sinónimo de gen:CAMK, CAMKG, CAMK-II, FLJ16043, MGC26678, CAMK2G
Especie:Human
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano CaMKII/CAMK2G transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano CaMKII/CAMK2G transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11125-ACG$245
Humano CaMKII/CAMK2G transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11125-ACR$245
Humano CaMKII/CAMK2G transcript variant 3 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11125-ANG$245
Humano CaMKII/CAMK2G transcript variant 3 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11125-ANR$245
Humano CaMKII/CAMK2G transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11125-CF$215
Humano CaMKII/CAMK2G transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11125-CH$215
Humano CaMKII/CAMK2G transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11125-CM$215
Humano CaMKII/CAMK2G transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11125-CY$215
Humano CaMKII/CAMK2G transcript variant 3 clonación del ADN o clonación génica(Vector de expresión)HG11125-M$75
Humano CaMKII/CAMK2G transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11125-M-F$215
Humano CaMKII/CAMK2G transcript variant 3 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11125-NF$215
Humano CaMKII/CAMK2G transcript variant 3 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11125-NH$215
Humano CaMKII/CAMK2G transcript variant 3 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11125-NM$215
Humano CaMKII/CAMK2G transcript variant 3 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11125-NY$215
Humano CaMKII/CAMK2G transcript variant 3 clonación del ADN o clonación génica(vector de clonación)HG11125-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG11125-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"