After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human CAPG Información de producto de clon de cDNA
Gene_bank_ref_id:BC014549
Tamaño de cDNA:1047bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens capping protein (actin filament), gelsolin-like.
Sinónimo de gen:AFCP, MCP, CAPG
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14213-ACG$225
Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14213-ACR$225
Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14213-ANG$225
Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14213-ANR$225
Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14213-CF$195
Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14213-CH$195
Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14213-CM$195
Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14213-CY$195
Humano CAPG / AFCP clonación del ADN o clonación génica(Vector de expresión)HG14213-G$75
Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14213-NF$195
Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14213-NH$195
Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14213-NM$195
Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14213-NY$195
Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación)HG14213-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

CAPG, also known as actin Regulatory Protein CAPG, is a a member of the gelsolin/villin family. Members of this family are actin-regulatory proteins. CAPG reversibly blocks the barbed ends of F-actin filaments in a Ca2+ and phosphoinositide-regulated manner, but does not sever preformed actin filaments. By capping the barbed ends of actin filaments, CAPG contributes to the control of actin-based motility in non-muscle cells. CAPG may also play an important role in macrophage function.

Referencias
  • Watari A. et al., 2007, Oncogene. 25 (56): 7373-80.
  • De Corte V. et al., 2005, J Cell Sci. 117 (22): 5283-92.
  • Van Impe K. et al., 2003, J Biol Chem. 278 (20): 17945-52.
  • Size / Price
    Catálogo: HG14213-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"