Pedido rápido

Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano CAPG Información de producto de clon de cDNA
    Gene_bank_ref_id:BC014549
    Tamaño de cDNA:1047bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens capping protein (actin filament), gelsolin-like.
    Sinónimo de gen:AFCP, MCP, CAPG
    Especie:Human
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CAPG qPCR primers for gene expression analysis, HP102863 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación) on other vectors
    Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14213-ACG$225
    Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14213-ACR$225
    Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14213-ANG$225
    Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14213-ANR$225
    Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14213-CF$195
    Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14213-CH$195
    Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14213-CM$195
    Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14213-CY$195
    Humano CAPG / AFCP clonación del ADN o clonación génica(Vector de expresión)HG14213-G$75
    Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14213-NF$195
    Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14213-NH$195
    Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14213-NM$195
    Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14213-NY$195
    Humano CAPG / AFCP clonación del ADN o clonación génica(vector de clonación)HG14213-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    CAPG, also known as actin Regulatory Protein CAPG, is a a member of the gelsolin/villin family. Members of this family are actin-regulatory proteins. CAPG reversibly blocks the barbed ends of F-actin filaments in a Ca2+ and phosphoinositide-regulated manner, but does not sever preformed actin filaments. By capping the barbed ends of actin filaments, CAPG contributes to the control of actin-based motility in non-muscle cells. CAPG may also play an important role in macrophage function.

    Referencias
  • Watari A. et al., 2007, Oncogene. 25 (56): 7373-80.
  • De Corte V. et al., 2005, J Cell Sci. 117 (22): 5283-92.
  • Van Impe K. et al., 2003, J Biol Chem. 278 (20): 17945-52.
  • Size / Price
    Catálogo: HG14213-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"